Please wait a minute...
Welcome to Chinese Agricultural Science Bulletin,

IMAGE/TABLE DETAILS

  • HtMYB2 Gene of Helianthus tuberosus L.: VIGS System Construction and Functional Validation
    WANG Ying, LI Juan, SUN Xuemei
    Chinese Agricultural Science Bulletin    2024, 40 (24): 116-121.   DOI: 10.11924/j.issn.1000-6850.casb2023-0749
    Abstract   (79 HTML1 PDF(pc) (1381KB)(8)  

    Color is an important agronomic trait that affects the value of crops. The purple-skinned Jerusalem artichoke has superior appearance, nutritional value, and commercial value compared to the white-skinned variety. To explore the mechanism of color formation in Jerusalem artichoke tubers, we utilized transcriptome sequencing technology to study both purple and white varieties. We identified the transcription factor HtMYB2, which is associated with anthocyanin synthesis and metabolism. In this study, the HtMYB2 gene in a purple Jerusalem artichoke variety was silenced using virus-induced gene silencing (VIGS) technology to verify its function. Results showed that the tuber epidermis color lightened after infection, anthocyanin content decreased to 15.34 mg/g, HtMYB2 gene expression was 2.06, and silencing efficiency reached 73.96% compared to the control group. It was speculated that silencing the HtMYB2 gene blocked the expression of anthocyanin-related genes in Jerusalem artichoke tubers, leading to reduced anthocyanin synthesis. The HtMYB2 gene positively regulated the anthocyanin synthesis pathway. This study provides a theoretical basis for understanding anthocyanin biosynthesis in the epidermis of Jerusalem artichoke tubers and highlights the importance of HtMYB2 in regulating tuber color and the anthocyanin biosynthesis pathway.


    Primers names Sequence of primers
    25s-F CTGTCTACTATCCAGCGAAACCA
    25s-R AGGGCTCCCACTTATCCTACAC
    HtMYB-Rt-F TGAGTCAGAATTGTAATACGAG
    HtMYB-Rt-R ACTCTTCCTGCATCGGTTTA
    表2

    表达分析引物

    Other Images/Table from this Article