Abstract: The promoter of tomato fruit-specific 2A11 gene in tomato was amplified by nested-primers PCR technology. DNA sequence analysis and homology comparison indicated that the result was to be proved to absent the segment of “tatattgttaacttcttgttgaattaaagcaat”from 621bp upstream transcription start site of 2A11 promoter gene and to share 61% homology with 2A11 promoter (GenBank ID M87659，1993). DNA sequence had been submitted to GenBank, and its GenBank submission number was DQ453963. Binary vector was constructed through fusing 1.3kb 2A11 promoter gene with the GUS gene. Transient GUS expressions were observed in tomato fruits transferred by Agrobacterium tumefaciens EHA105. The result of GUS transient expression in tomato fruit indicated that 2A11 promoter had the function of driving the GUS gene fruit-specific expression in tomato fruit. Tomato fruit-specific 2A11 promoter had been successfully cloned in this paper, thus making possible the subsequent research in oral vaccine of transgenic tomato.