Current issue

• 2006 Vol.22 No.10 Published:05 October 2006

  园艺园林科学

  Study on the Identification Technique System of Heat Tolerance for Radish Ran Maolin, Song Ming, Song Hua, Yong Xiaoping 2006, 22 (10):  .  Abstract + ( 1486 )   The quality character and physiology and biochemistry were studied, which is based on field identification of radish. The electric conductivity percentage and high temperature cause death time was used menstruated heat tolerance of radish. Identification technique system for radish heat tolerance has been put forward in this paper, which combined with field identification and physiology identification. It includes three-kind independent methods: First, field identification that is with the heat injury index according to the fresh weight unit area of seedling and death rate of plant in summer. Second, yield identification that is including radish yield and effective root rate. Third, physiology identification that is including the electric conductivity percentage and high temperature cause death time. In the period of radish to grow leaf the fresh weight unit area was menstruate; and then in the period of radish to grow root the leaf heat injury index and death rate of plant in summer were menstruate, also the electric conductivity percentage or high temperature cause death time; Finally radish yield and effective root rate were menstruated in the harvests and accomplish to synthesize evaluation heat tolerance of radish. Three kinds of methods can be used alone, and also can be used together. It can receive the same result.

  畜牧兽医科学

  Influence of Lactulose of Immunity on Calves in Perinatal Period Ran Xiaobo, Zuo Fuyuan, Zhang Jiahua 2006, 22 (10):  1-1.  Abstract + ( 1335 )   PDF ( 291184KB )   ( 528 ) In order to study the effect of lactulose as substitute for antibiotic, this experiment had been carried on 25 newborn Holstein male calves which had been born by same passel youth cows from Australia in the same dairy farm. Calves had been divided into 5 groups (5 calves each group)conform to the born time. Unit group design had been used to make the certain additive of each calf in perinatal period(from firstborn to 15th day). Feed additives were: A: control group;B: aureomycin group, 10000 IU/d from 3rd day to 15th day; C: admixture group, lactulose & aureomycin; D: lactulose group, 10g/d one calf; E: lactulose group, 15g/d one claf. The results were as follows: Lactulose had no significantly effect(p>0.05) to immunity organ index, B&T lymphocyte quantity in the blood. From 24h, the lymphocyte conversion rate of lactulose groups were significantly more than control group and aureomycin group(p<0.01). Lactulose and aureomycin have coordination effect to promote conversion rate. Lactulose enhanced the content of CRP&IgG in the blood of calves. Aureomycin has coordination effect with the lactulose, but the promoted effect of aureomycin was inferior to lactulose.

  Effects of Copper lysine on Serum Reproductive Hormone Level during Estrous Cycle in Simmental Heifers Wang Cong, Huang Yingxiang, Yue Wenbin, Liu Qiang, Meng Jie 2006, 22 (10):  7-7.  Abstract + ( 1368 )   PDF ( 292385KB )   ( 533 ) Sixteen Simmental heifers (average BW 380kg, aged 18 monthes) consuming a corn straw diet were chosen and allocated into four treatments and supplemented with four levels (0, 8, 16 and 24 mgCu/kg of DM) of supplemental copper lysine to evaluate the effects of copper on reproductive hormone excretion during the oestrous cycle. The results showed that serum estradiol, luteinizing-hormone, follicle- stimulating hormone and progesterone concentrations were increased significantly (P<0.05) by supplemental copper lysine at 8-16 mgCu/kg of DM than control group. Serum estradiol, estriol, luteinizing-hormone, follicle-stimulating hormone and progesterone concentrations were increased by supplemental copper at 24 mgCu/kg of DM, but no significant difference with control (P>0.05). This results suggested that copper lysine had positive effects on reproductive hormone during estrus cycle by supplemental copper at 8 mgCu/kg of DM. Considering the copper content of basal diet, the optimum copper level of diet is 13.87 mgCu/kg DM。

  Carry-over effects of Exogenous Alpha-amylase Supplementation on Development of Digestive Organs and Intestinal Enzyme Activities of Young Broilers Jiang Zhengyu, Zhou Yanmin, Wang Tian 2006, 22 (10):  13-13.  Abstract + ( 1660 )   PDF ( 374454KB )   ( 471 ) Three hundred and thirty 1-day-old AA broiler chickens were randomly allocated to three groups for 5 replicates with 22 broliers each, and fed a commercial starter diet and the same diets supplemented with 1,000U/kg (250mg/kg), 9,000U/kg (2250mg/kg) of α-amylase preparation up to 7 day of age, followed by three-week removal of amylase, to investigate possible carry-over effects of short-time enzyme supplementation on the development of digestive organs and intestinal enzyme activities. The results showed: there was no apparent effect of supplementary amylase on relative weights of liver, gizzard, proventriculus, relative length of small intestine, and the activities of amylase and protease in small intestinal contents. The relative weight of small intestine, however, increased by 4.2%~47.6% on day 7, by 5.4%~34.0% (P<0.05) and 13.8%~20.4% after 3 days (day 10) and 7 days (day 14) removal of dietary amylase, respectively. On day 21, all the parameters of digestive organs remained paralleled. A significant depression of intestinal amylase activity of all experimental groups were observed after 7 day removal of dietary amylase. The activity of intestinal protease was unaffected in all periods. These results implied that exogenous amylase had a carry-over effect on the endogenous enzyme activity in broilers.

  目次

  Isolation and Molecular Identification of Very Virulent Infectious Bursal Disease Virus Wang Guijun, Wu Yichun, Wei Jianzhong, Li Yu, He Changsheng, Wei Ping 2006, 22 (10):  17-17.  Abstract + ( 1245 )   PDF ( 664619KB )   ( 712 ) 3 strains of infectious bursal disease virus (IBDV) designated as CH03, JG04 and QJ04, were isolated and identified from bursa tissues of infected chickens of Anhui province by chicken embryo inoculation, AGP test and electronic microscopy. 4-week-old chickens, which were unvaccinated of IBDV, were inoculated with the tree isolates and experienced severe clinical disease with the mortalities of 92%, 83% and 67%, and the ELD50 of 3 isolates were 10-6.8/0.2ml, 10-5.4/0.2ml and 10-4.6/0.2ml, respectively. The VP2 hypervariable regions (vVP2) were amplified by RT-PCR (reverse transcriptase polymerase chain reaction) /Nested PCR and sequence analysis of the amplified products showed that the corresponding drifts of amino acids were found at five different epitopes: P222A located in the first hydrophilic region, K249Q, S254G, N279D and T284A located in the hydrophobic region, respectively. The results demonstrated that these 3 isolates were classified to be very virulent infectious bursal disease virus (vvIBDV) since they possess the epitope characteristics of vvIBDV but no that of attenuated or variant IBDV.

  畜牧兽医科学

  Effect of Spraying Trace Elements on the Yield and Quality of Medicago Sativa Jie Xiaolei , Hu Huafeng, Guoxiao, Zhen Yimin, Zhang Bingyun 2006, 22 (10):  22-22.  Abstract + ( 1622 )   PDF ( 136857KB )   ( 568 ) Based on the ample N、P、K fertilizer, Adopting the method of spraying leaf’surface, the experiments was conducted to investigate the effect of 8 kinds of trace element fertilizers （Zn、Fe、Mo、Co、B、Cu、Se、Mn ）mixed spraying on the Yield of forage and quality of Medicago sativa, The purpose is by the examination of spraying trace elements, In order to provide the fine pastuer for different productive uses, The results showed that spraying trace elements could remarkably increase the yield of forage and the leaf stem ratio (LS), significantly increase crude fiber’s contents, markedly affect the crude fat’s contents, promoted the enhancement of crude ash’s contents and reduced nitrogen-free extract’s contents, but the effect of spraying trace elements on crude protein and phosphorus’s contents of Medicago sativa was inapparent.

  Study of the Influence of Bifidobacterium to Spleen little Mouse Intestinal Bacteria Zhao Hongmei, Zhao Jian, Feng Jianyuan 2006, 22 (10):  26-26.  Abstract + ( 1233 )   PDF ( 103137KB )   ( 442 ) After treating with Bifidobacterium on spleen-deficiency mice, the quantities of main bacteria in colonic contents and feces of mice such as Enterobacteriaceae, Enterococcus, Bifidobacterium, Bacterocdaceae and Lactobacillus were detected. Results showed that Result: the quantities of Bacterocdaceae and enterococcus microbiota in spleen-deficiency mice were increased (P＜0.05). However, bifidobacteria and Lactobacillus were decreased (P＜0.01). After treating with Bifidobacterium 6d~12d, the quantities of Bacterocdaceae and enterococcus microbiota in spleen-deficiency mice were decreased (P＜0.05). However, bifidobacteria and Lactobacillus were increased (P＜0.01). Observation of histology in colorectal indicated thickness of the intestine muscle layer and quantity of the cup cell was increased and villi interstinales arrange order on intestines mucous membrane was become better.

  Study on the Effects of Bromocriptine Mesilate and Clomifene Citrate on Rivival from Incubation and Eggs’ Quality of Silki Hens Fan Jiaying, Zhao Jinyan, Huang Yankun 2006, 22 (10):  29-29.  Abstract + ( 1354 )   PDF ( 91299KB )   ( 486 ) The effects of bromocriptine mesilate and clomifene citrate on broody days, reproductive performance, eggs’ quality of broodying silki hens. 36 broodying silki hens were alloted randomly to 3 groups: hens of trail 1 were given bromocriptine mesilate per os 2 days(1.25mg/day/hes), then clomifene citrate 5 days(12.5mg/day/hen); hens of trial 2 were given bromocriptine mesilate 4 days, then given clomifene citrate 3 days. The results showed that the average brooding days of trial 1 was 6.67 days, that of trial 2 was 6.83 days, that of control group was 8.58 days. Average lay rate within 30 days were 37.72%(control group), 59.65%(trial 1), 53.51%(trial 2) respectively, trial group was obviously higher than control group(P<0.05). Average egg size of control group, trial 1, trial 2 were 43.86g, 44.65g, 44.16g respectively, and average egg shape index were 1.306, 1.312, 1.323 respectively, and average egg shell thickness were 0.327mm, 0.338mm, 0.332mm respectively. The effects of bromocriptine mesilate and clomifene citrate on egg size, egg shape, egg shell thickness were not obvious(P＞0.05).

  目次

  Palatability Measuring of Four Tropical Forage Cultivars Via House Feeding Hainan Yellow Cattle Hou Guanyu, Bai Changjun, Wang Dongjin 2006, 22 (10):  32-32.  Abstract + ( 1643 )   PDF ( 100275KB )   ( 598 ) In this research the palatability of four tropical forage cultivars, Pennisetum×P.americanum cv.Reyan No.4、Stylosanthes guianensis cv.Reyan No.2、Paspalum atratum、Panicum maximum jacq.cv.Reyan No.8, were measured with the index of intake speed and quality via house feeding Hainan Yellow cattle during the vegetative growth. The results indicated: 1 for the intake speed Pennisetum×P.americanum was the highest, there was no significant difference between that of Paspalum atratum and Stylosanthes guianensis, Stylosanthes guianensis and Panicum maximum jacq, but that of Panicum maximum jacq was significantly lower than that of Stylosanthes guianensis; 2 for the intake quality the orders was Pennisetum×P.americanum＞Paspalum atratum＞Stylosanthes guianensis＞Panicum maximum jacq. Based on the above results the palatability of the four cultivars was also be ordered as Pennisetum×P.americanum＞Paspalum atratum＞Stylosanthes guianensis＞Panicum maximum jacq.Suggest when house feeding ,with 64% Pennisetum×P.americanum cv.,16% Stylosanthes guianensis cv.,15% Paspalum atratum and 5% Panicum maximum jacq’s is a reasonable recipe construction.

  Study on the Effect of Polysaccharide from Portulaca oleracea L.on Mice Anti-senility N iu Guangcai , Zhu Dan, Jin Yingzi, Piao Yongquan 2006, 22 (10):  35-35.  Abstract + ( 1783 )   PDF ( 107989KB )   ( 537 ) To observe the effect on SOD and GSH-PX activities, MDA content in serum, the survival time under hypoxic condition and swimming time of mice with senile model caused by D-galatose and meanwhile administered with polysaccharide from Portulaca oleracea L.(POP)of 100, 200, 400 mg/ orally, the results showed that SOD and GSH-PX activities in serum differently rose, MDA content significantly dropped. Meanwhile, the survival time under hypoxic condition and swimming time were significantly prolonged. It was found that POP had the obvious effect on anti-senility.

  畜牧兽医科学

  The Weight Effect ion on the Growing-finishing Pigs by Adding the EM Fermentation Rabbit Excrement to the Date Grain Wang Jiafu, Yin Wei, Zhang Zhuyun, Yang Linfu, Yin Liehong 2006, 22 (10):  38-38.  Abstract + ( 1437 )   PDF ( 112665KB )   ( 489 ) Eighteen growing-finishing pigs on the average weight of (35±2.1) kilos were selected in this experiment and were divided into 3 groups. We fed the control group on basal date grain and added respectively 15% and 25% of fermentation rabbit excrement to the date grain to raise the treatment groupⅠ and the treatment group Ⅱin the 81 days of contrast experiment. The experiment result indicated that the intake of the treatment groups was more than the control group and the daily gain of the treatment groupⅠ and the treatment groupⅡ were respectively slower in the ratio of 1.84% and 8.3% than the control group. According to the economic profit analysis, the ration cost of the treatment groupⅠand the treatment group Ⅱ reduced respectively 0.19￥and 0.25￥when the weight of the growing-finishing pigs increased one kilo.

  Effect of Phytase and Compound Enzymes on Performance of Broilers and Environment Wang Zhangcun, Liu Weidong, Wang Lei 2006, 22 (10):  41-41.  Abstract + ( 1400 )   PDF ( 101761KB )   ( 528 ) Objective: To investigate the effect of Phytase and Compound Enzymes on Performance of Broilers and Environment; Methods:1600 one-day AA broilers were randomly allocated to 4 treatments with 4 replicates. Control group with base diet, experimental group 1, 2 and 3 with adding 0.1% Compound Enzymes, 0.01% Phytase and 0.1% Compound Enzymes＋0.01% Phytase in base diet respectively. Results: compared with Control group, daily gain and feed efficiency in group 3 is best, then group 1 and group 2. Result: The fecal nitrogen in group 1,2,3 decreased 10.21%, 5.64% and 12.04% respectively, faecal phosphorus in group 1,2,3 decreased 2.04%, 30.61% and 31.63% respectively; the ammonia of henhouse in group 1,2,3 decreased 20.48%, 13.07% and 23.98%, the sulfureted hydrogen of henhouse in group 1,2,3 decreased 19.66%, 15.10% and 29.30% respectively. Conclusion: Phytase and Compound Enzymes improve performance of broilers and decrease pollute substance release.

  生物技术科学

  Analysis of DNA Polymorphism in Peanut Cultivars Using New Microsatellite Markers Huang Xinyang, Wang Chuantang, Yang Xindao, Xu Jianzhi 2006, 22 (10):  44-44.  Abstract + ( 1369 )   PDF ( 1143500KB )   ( 526 ) SSR primers published for peanut, along with those from a strategy involving hybridization enrichment, library construction were evaluated using 12 peanut cultivars mainly from Shandong. Cluster analysis was carried out based on simple matching coefficients between varieties. The results showed that 44 SSR primer pairs were found to produce 176 bands , and 107（60.8%）were polymorphic. On an average, each primer pair produced 2.43 polymorphic bands in a total of 4 bands. The polymorphic percentage and PIC ranged from 11.1%~100% and 0.245~0.886, respectively. The average of PIC was 0.677.The result of cluster analysis indicated the majority of 12 accessions could be divided into three groups（Ⅰ、Ⅱ、Ⅲ）. The result showed that microsatellites are very useful DNA marker to analyze DNA polymorphism in cultivated peanut..The high genetic similarity of Shandong peanut at DNA level indicated gene bases, which need broadening in cultivar breeding through utilization of elite exotic germplasm resources.

  农业生物技术科学

  Cloning and expression of VP7 gene of African horse sickness virus Zeng Zhaowen, Hua Qunyi, Duan Gang, Zhou Xiaoli, Dong Jun, Yang Yunqing, Yin Shanglian，Xiang Xun, Chang Hua 2006, 22 (10):  49-49.  Abstract + ( 1581 )   PDF ( 439420KB )   ( 609 ) To obtain the African horse sickness virus (AHSV) VP7 protein, which is used to preparing serological diagnostic reagent and constructing AHS new generation vaccine, the prokaryotic expression is used to express VP7 protein. The VP7 gene was synthesized from the database of GeneBank, then the VP7gene was cloned into pBAD/Thio-TOPO vector, and the recombinant plasmid was transferred into Escherichia coli TOP10. The recombinant plasmid was sequenced to confirm the correct sequences and the correct junctional orientations of the inserted VP7 gene. The results of SDS-PAGE revealed that the VP7 recombinant fusion protein was expressed in TOP10 in a high level and the optimal amount of the expressed fusion protein is being induced with L-arabinose at 0.2% concentration for 4 hours. It had a molecular mass of approximately 54.72 kDa. The results of Western blotting and indirect ELISA revealed that the fusion protein is able to react with ASHV VP7 monoclonal antibody and they suggest that the fusion protein has immunologically reactive activity.

  生物技术科学

  Induction of Substances Related to Resistance in Host to Shealth Blight of Maize by Bio-seed-coating Agent Li Ronghua,, Chen Jie,, Tang Baohong, Liu Junhua 2006, 22 (10):  54-54.  Abstract + ( 1394 )   PDF ( 164092KB )   ( 527 ) Dynamic the effective function of biological seed coating ZSB and changes of in active of peroxideases (POD), polyphenoloxides (PPO) and phenylalantine ammonia lyases (PAL) in two resistant cultivars and two susceptible ones of maize after inoculating Rhizoctonia solani. ZSB was assured with effective function to control sheath blight of four cultivars of maize, and the effective function to Washi13 and Shenshi28 was 39% and 49.7%, higher than to Yedan13 and Shenshi29. It was more likely that ZSB control effect was devoted by its induction to PPO and POD in host prior to and higher than inoculation with R. solani,. It should be noted that some special phenomenon needed to be further investigated such as still no significant increase of PAL.

  目次

  The study of liquid fermentive condition of Trichoderma pseudokoningii Guo Min, Chen Kaoshan, 2006, 22 (10):  58-58.  Abstract + ( 1506 )   PDF ( 472482KB )   ( 621 ) The liquid fermentative condition of Trichoderma pseudokoning?? were studied through single factor and orthogonal design tests. The experimental results showed the optimized fermentative conditions are as follows: Culture medium formula is wheat bran 30g/L, corn meal 30g/L, sucrose 7.5g/L,KH2PO41g/L. The optimum fermentation period is 6d. The fermentation temperature and the initial pH-value of culture medium is 30±1℃ and 5.0~6.0 respectively. The mycelial dry weigh and the extracellular polysaccharides of Trichoderma pseudokoningii reached 5.272 g/L,0.622 g/L under the the optimized fermentative conditions.

  生物技术科学

  Cloning and Functional Analysis on Promoter of Tomato Fruit-specific 2A11 from Lycopersicon esculentum Lin Bingying,, Li mei, Lin Deqin, Jin Zhiqiang 2006, 22 (10):  62-62.  Abstract + ( 1928 )   PDF ( 1136100KB )   ( 719 ) The promoter of tomato fruit-specific 2A11 gene in tomato was amplified by nested-primers PCR technology. DNA sequence analysis and homology comparison indicated that the result was to be proved to absent the segment of “tatattgttaacttcttgttgaattaaagcaat”from 621bp upstream transcription start site of 2A11 promoter gene and to share 61% homology with 2A11 promoter (GenBank ID M87659，1993). DNA sequence had been submitted to GenBank, and its GenBank submission number was DQ453963. Binary vector was constructed through fusing 1.3kb 2A11 promoter gene with the GUS gene. Transient GUS expressions were observed in tomato fruits transferred by Agrobacterium tumefaciens EHA105. The result of GUS transient expression in tomato fruit indicated that 2A11 promoter had the function of driving the GUS gene fruit-specific expression in tomato fruit. Tomato fruit-specific 2A11 promoter had been successfully cloned in this paper, thus making possible the subsequent research in oral vaccine of transgenic tomato.

  Study on In Vitro Culture and Plant Regeneration in Citrus Reticulata Blanco Epicotyl Lu Xudong., Liu Huaying, Xiao Langtao 2006, 22 (10):  67-67.  Abstract + ( 1484 )   PDF ( 101709KB )   ( 465 ) We studied effects of different hormones and combination on buding and rootting of Citrus reticulata Blanco epicotyl in tissue culture. The results showed 100% buding ratio in MT+6-BA2mg/L when epicotyl was vertical inserted. The buding was restrain in MT medium with only ABA0.2 mg/L, GA30.4 mg/L and GA30.4 mg/L+6-BA2 mg/L. But buding was promoted in MT medium with ABA0.2 mg/L+ 6-BA2 mg/L.The rootting was the best(87.5% rootting ratio ) in 1/2MT+NAA0.5 mg/L.

  Study on Herbicide Resistant Transgenic Rice and Its Biosafety Meng Yingying, Li Kebin, Wu Zhongyi, Chang JingLi, Yang Deguang, Liu Xuetang, Fu Jianye 2006, 22 (10):  70-70.  Abstract + ( 1579 )   PDF ( 139047KB )   ( 1166 ) Herbicide resistant transgenic rice plays a domination role in the research and utilization of transgenic rice. But its safety has attracted people’s attention. In this paper we reviewed the kinds and mechanisms of herbicides mainly used in rice, the methods of genetic transformation and the mechanisms of herbicide resistant. we also discussed the biosafety and prospected the study and application of herbicide resistant transgenic rice.

  农业生物技术科学

  Comparative Study on the Variation of Agronomy Traits of Transgenic Insect Resistance Rice Yu Chao, Feng Ying,, Xue Qingzhong 2006, 22 (10):  75-75.  Abstract + ( 1273 )   PDF ( 238068KB )   ( 631 ) Based on BSA (Bulk sergeant analysis) and comparative analysis, the paper focus on the effects of heredity background and foreign gene(s) on the variation of main agronomy traits with three F2 populations and DH population derived from hybridization of high generation transgenic rice and non-transgenic rice. And the results can be summarized as follow: the father’s genotype has a certain effect on the performance of agronomy traits; Compared with foreign gene not containing plants, the foreign gene containing plants in three F2 populations show degenerate trends in some main agronomy traits, such as longer days to heading, lower plant height, lower fertility and larger variation coefficient. But in DH population, although the variation coefficient of foreign gene containing lines is significantly higher than foreign gene not containing lines, there are no significant differences in the main agronomy traits between the two groups, which indicate tissue culture is the main reason of agronomy traits and the introduction of foreign gene(s) enlarged the chances of variation.

  The Selection of Antibiotics and Their Concentration during Gene Transformation via Leaf Disc Regeneration System in Apple Zhang Lili, Shi Xiaoxin, Du Guoqiang, Feng Shasha, Zhang Junge 2006, 22 (10):  80-80.  Abstract + ( 1653 )   PDF ( 185215KB )   ( 723 ) It was studied that the effect of Kanamycin and Hygromycin on the growth of subcultured explants and the efficiency of adventitious bud regeneration from leaf disc, and the effect of the concentration of Cefotaxime and Carbenicillin on the efficiency of regeneration and the preventing growth of Agrobacteriua strains EHA 105 and LBA4404. The results showed that the supplying of Kanamycin 10 mg/L or Hygromycin 4.0 mg/L in the media could restrict the adventitious bud regeneration in a greatest extent, and it could be used as a selecting pressure for the regeneration of adventitious buds with antibiotic-resistant. The supplying of Kanamycin 50 mg/L or Hygromycin 5.0 mg/L in the media could led half of the subculture plantlets to death, and it could be used for the selection of transgenic plantlets with antibiotic-resistant. The Hygromycin is considered to be more useful than Kanamycin as a selecting marker during gene transformation in apple, since the difference of the concentrations of Hygromycin used for the adventitious bud regeneration and the plantlets selection is less than that of Kanamycin. The supplying of Cefotaxime 300 mg/L could eliminated the growth of Agrobacteria eventually without affecting the adventitious bud regeneration from leave. But the supplying of Carbenicillin should be more than 400 mg/L to obtain the well controlling, and that seriously limited the adventitious bud regeneration. Then, it suggests that Cefotaxime should be used for the eliminating of Agrobacteria strains EHA105 and LBA4404.

  生物技术科学

  Study on the Optimization of Inducing Potato Microtuber System in Different Varieties Zhang Tianyu, Zhang Junlian,, Wang Di,, Wang Li, Cui Yansen, Du Ximei, Liu Yuhui, Li Youzhong 2006, 22 (10):  85-85.  Abstract + ( 1182 )   PDF ( 148100KB )   ( 477 ) Potato microtubers of Atlantic, Longshu3 and Gannongshu2 were induced by using 5 mediums and 3 culture methods. The result showed that 8 percent sucrose was the best concentration of inducing Atlantic and Longshu3’s microtuber; Adding 5mg/L 6-BA could improve the rate of microtuber setting and increase microtuber’s diameter; In the 8 percent sucrose medium, agar didn’t affect the rate of microtuber inducing; In the MS medium of no sucrose, 300μmol/L sorbitol added with 20mmol/LNH4NO3 and 20mmol/LKNO3 was harmful to forming and growth of microtuber; In the 3 methods, liquid method was the best method in inducing microtuber.

  Analysis of a wheat mutant with high tillering created by T-DNA He Daoyi, Wang Xuming, Chen Chu 2006, 22 (10):  89-89.  Abstract + ( 1422 )   PDF ( 572465KB )   ( 510 ) Several wheat cultivars were transformed in planta by Agrobacterium tumefaciens and numbers of transformants were gained. A mutant with high tillering was found in the transmants of the wheat cultivar Lumai 21. The mutant was identified with part of T-DNA sequence by PCR and Southern blot and displayed a recessive gene mutation. Mutant plants of T3 were found with part of T-DNA sequence by PCR. This indicated the mutant was created by T-DNA. Primary analysis suggested that the mutation gene is relative to plant response to temperature. Tiller number of the mutant increased much more than that of the wild parent with temperature decrease.

  In vitro Culture of Interspecific Hybrid Ovaries on Brassica napus and Brassica oleracea L. var. italica Phenck Tang Zheng,, Liu Qing, Zhang Xiaoling, Luo Tiankuan, Hu Caiying 2006, 22 (10):  93-93.  Abstract + ( 1389 )   PDF ( 989042KB )   ( 466 ) Interspecific hybrid of Brassica napus and Brassica oleracea L. var. italica Phenck was obtained by in vitro tissue culture of ovaries. The best data of in vitro culture of ovaries, which was pollinated 15 days ago, resulted in 7 full seeds (including 2 sprouts) and a germination rate of 29%. The most appropriate culture medium was 1/2MS+B5 organic + IAA 1.5mg/L + sucrose 50g/L on which we had average 0.17 hybrid seeds per legume and a germination rate of 66.7%. We drew a conclusion that biological characters of this interspecific hybrid were mostly similar to those of male parent in comparison with both parents.

  农业基础科学

  Study on the Characters Description of Lilium from Qin-ba Mountain and its Adjacent Area Xiang Diying, Zhang Yanlong, Hao Ruijie 2006, 22 (10):  97-97.  Abstract + ( 1508 )   PDF ( 123104KB )   ( 492 ) Through principal component analysis and cluster analysis to the 68 characters, it indicated that the main characters groups which affected lilies classify are as follows: flower comprehensive characters, leaf comprehensive characters, germplasm characters, andappendix characters.The analysis results also indicated that petiole, pedicel lenth, scale color, stem papillae and anther lenth were important class characters of wild lilies.The 25 characters choosed by principal component analysis and cluster analysis can reflect the difference objectively among different species, and divide these lilies into two groups.The morphology and phenological characters were described combination with ornament and garden’s needs.

  Morphology and Anatomy Characteristic of Resource Foliage—Juema Yu qinglan, Li junqiao 2006, 22 (10):  101-101.  Abstract + ( 1506 )   Juema (Potentilla anserina L.) is a unique natural germplasm resource of Qinghai-Tibet Plateau, and also officinal and edible plant, which is planted widely in high altitude area. A combination of morphology and anatomy was employed to investitate the character of Juema(Potentilla anserina L.) and the connection with its existent environment, the result as follows: Juema is perennial herbage, the stolons cling to odd-pinnate leaf with floss in back, the root tuber figure is spindle, globosity or stick, and so on. More palisade mesophyll than spongy mesophyll was observed in microstructure of leaf, pith tissue and pidermic collenchyma are developed in the stem transverse section of the stolon, vascular tissue arrange tightly to form circuit shape like cylinder, the ratio of vascular tissue to ground tissue is less. Its root tuber has multilayer concentric circularity similar to “annual ring lines” at the initial stages of development, and grows and enriches at the same year. The morphology and anatomy characteristic of Juema is typical drought xero- structure.

  林业科学

  Seasonal dynamics of structure and diversity of insect communities in the poplar nursery Wang Jingshun, Liu HuiSun Sanhu, Wang Caixia, 2006, 22 (10):  104-104.  Abstract + ( 1525 )   Systematic investigation and analysis of insect community in the poplar nursery were carried out from April to October 2005. The results indicated that there were 11639 individuals belong to 27families, 41 species. Proportions of different groups and Seasonal dynamic of dominance species were compared. The seasonal dynamic characteristic and mechanism of individuals, species richness ,evenness and diversity index were also analyzed.

  农艺科学

  Effects of Halving Spikelet on the Wheat Grain Quality under Short Period of Heat Shock at the middle Stage of Grain Filling Zhang Bin, He Mingrong, Wu Cuiping, Wang Shanshan, Liu Yonghuan, Zhang Honghua 2006, 22 (10):  108-108.  Abstract + ( 1361 )   Selecting wheat cultivar Jimai20 as experiment material, under short period of heat shock (35~39℃) at the middle stage of grain filling , the effects of halving spikelet on 1000-grain weight and quality of wheat grain were investigated. The results showed that 1000-grain weight, protein concentration, protein accumulation amount per grain, wet gluten content, flour development time and flour water absorption were improved comparing with the treatments of CK and Heat Shock without halving spikelet . Mixing tolerance index and time to breakdown diminished. Meanwhile, the concentration of starch and amylopectin decreased, amylose content and ratio of amylase to amylopectin increased. The breakdown value and peak viscosity of flour diminished. It was indicated that resulting from improved nitrogen supply to the remained grain by halving spikelet, the rheological properties of dough become more resistant to heat shock but the quality of starch was worsen.

  The Biological Characteristics for Super-hybridization Rice “II Youhang No.1” Zheng Jiatuan, Wang Wuqi, Zhang Jianfu Huang Tingxu, Tu Shihang, Li Yizheng，Zhuo Chuangyun，Wu Fangxi, Zhang Shuijing, Xie Hua’an 2006, 22 (10):  111-111.  Abstract + ( 1696 )   “IIYouhang No.1” is a new variety by the Space-Flight. The cultivated area of “II Youhang No.1” is 266,700 hm2 from 2003 to 2005, the total yields were about 120 million kg in three years. Its characteristics was super-high yield, high quality, cold tolerance in seedling stage, high temperature tolerance at heading stage、large panicles、more spikelets, high setting rate, wide adaptability and strong ratoon ability. It was registered in Fujian province Crops Variety Approval Committee and the National Crops Variety Approval Committee in 2004 and 2005 respectively, and approved in Guangxi province in 2005. It was one of those super-hybridization varieties (combinations) to be demonstrated and extended in national wide and Fujian province. The extension and application, botanical traits and yield components of “II youhang No.1” have been summarized in this paper, and its yield, resistance and quality in provincial trials, producing trials and high yield demonstration under an area of 6.67、66.67、666.67 hm2 also have been introduced.

  Application, Breeding method, Pedigree and Characteristics of Respectfully yours, Egistered rice Cultivars Bred by Yangzhou Academy of Agricultural Science Zhou Changhai,, Zhang Hongxi, Dai Zhengyuan, Zhang Hongsheng 2006, 22 (10):  116-116.  Abstract + ( 1284 )   Since 1980 the total 31 rice cultivars have been bred and registered by the researchers of Yangzhou Academy of Agricultural Science. Most of them have been applied in various eco-areas of rice-growing, which results in enormous social and economic efficient. Through the comprehensive analysis of those cultivars, including their pedigree, main agronomic characteristics, breeding method and extension strategies, it is intended to make some successful experiences adopted in future rice breeding. It is usually recommended to follow the breeding strategy “Balance development of indica and japanica, pure and hybrid rice; Outstanding improvement of main characters based on best designing of all characteristics for each variety”, and make out breeding objects for breeding commercial cultivars that could be suitable to the various ecological conditions and farming systems, and needs of agricultural production and people’s living. In aspect of pure varieties of indica rice BG902, one landrace from Sri Lanka, and some IR accessions from IRRI were used as parents to breed eight cultivars named from Yangdao No.1 to Yangdao No.8 by general selection, hybridization, step’s hybridization and shuttering back and forth breeding. All of these fourteen cultivars were gradually improved in the characters related yielding and resistance to diseases. In the aspect of pure Japanica rice some varieties with better resistance to pests introduced from Japan and several landraces from Taihu area were used as parents to breed at least six cultivars, which were suitable to growing in various ecological conditions and systems. As to the breeding of hybrid rice the CMS-restoring lines was a key problem. One wide compatible accession 02428, some intermediate lines from indica×japanica, restorers×resistant lines and some others were used parents to create elite restoring lines with high compatible and CMS-restoring abilities. Meanwhile the grain quality has been paid attention during the selection of new cultivars. More than fifteen hybrid rice combinations have been bred in the past decades. In order to enhance the creating ability in rice breeding the researchers always have close cooperation with institutions. They could get the new materials with various elite characters as well as fundamental information in time from scientists there. During the extension of new cultivars a net work including various disciplines, research fields and levels was formed to promote transformation and back-up of information. It is also gradually completed that the new type of developmental system involved in breeding, reproduction of seed, extension, production, procession and trading. It is assured that the commercialization of new scientific achievements.

  SPSS for Evaluation on the Quality of flue-cured Tobacco Varieties Zhao Mingqin, Wang Yusheng, Liu Guoshun, Zhao Mingshan, Hu Huanxing, Cheng Yuyuan, Liu Jinxia, Su Changtao 2006, 22 (10):  128-128.  Abstract + ( 1707 )   PCA based on SPSS was used to evaluate the qualities of 9 flue-cured tobacco Varieties in NanYang. The results show that the evaluation was very similar with the planting fact of the varieties, so using the method to evaluate the qualities of flue-cured tobacco can get a better effect.

  Synchronous Expression of pta and CryIA(a) Gene in Maize Yuan Ying, Li Qiyun, Kong Xiangmei, Liu Depu 2006, 22 (10):  131-131.  Abstract + ( 1568 )   Different genotype of maize inbred lines (7922, 8902, 4112, 340, 853) were used to study the relationship between somatic embryo formation and regeneration frequency. Results showed that 7922 had a regeneration frequency of 74.4% in somatic embryo pathway, while 8902, 4112, 340 and 853 had a regeneration frequency of 8.2%, 12.7%, 0%, 11.88% in adventitious buds pathway. It concluded that 7922 was the best genetic transformation receptor in this experiment. Mutation frequency would be accumulated with increasing somatic callus subculture times, therefore, subculture times should be decreased for high transformation frequency. A aggregated construct with bar, cryIA(a) and pta, named p3300-bt-pta, was transformed into 7922 calli by PDS-100. Herbicide (phosphinothricin, PPT3mg/L) resistance screening indicated that there were 22 individual putative transformed plants with herbicide resistance in total. PCR detection further revealed that there were 7 individuals with three resistant genes integrated and cointegration frequency was 31.8%. In conclusion, it is feasible to introduce multi-resistant-genes into maize to get transgenic maize with multi-resistance to Lepidoptera insect and Homoptera insect in a single transgenic event.

  Analysis of Climatic Safety after Spraying with CHA-BAU9403 in Wheat Cheng Xiyong, Xu Haixia, Dong Zhongdong, Zhan Kehui 2006, 22 (10):  135-135.  Abstract + ( 1435 )   Male sterility of wheat inducing by Chemical hybridization agents (CHA) is one of the main ways to produce hybrid wheat seed. BAU9403 is a new type of CHA which made in China agricultural University. Climatic safety evaluation after spraying with BAU9403 in wheat was studied in this paper. The result showed that the male sterility rate in wheat cultivar Yunong 9901 was 100% when spraying BAU9403 with the dosage of 0.8kg/hm2. A little decrease in male sterility rate was found after five hours when spraying with the water; while no significant decrease in male sterility rate was happened after eight hours when spraying with the water. If raining happened during one to five hours after spraying BAU9403, it is necessary to spraying the CHA with the dosage of 0.2kg/hm2.

  目次

  Different Fertilization Influence the Yield Indexes of Sweet Buckwheat on Dingxi Zhang Junke, Jin Xiaojun, Wang Jianjun, Nan Xiange 2006, 22 (10):  138-138.  Abstract + ( 1393 )   Comparasion experiments on the different fertilization. Use the whole comparasion among the indexes such as the plant height .branch ,yield and water use efficiency. We can get the conclution that the optimum getting fertilizer in Dingxi is the Urea 22.5kg/hm2. P2O5kg/hm2 and K2O4 65.48kg/hm2.And the plant height is 73.4cm.The branch is 4.4.The yield is 896.18kg/hm2.The water use efficiency is 5.38kg/hm2.mm.

  农艺科学

  Screening Of and Water-saving Farming Practices For Drought-resistant Cotton Varieties Wang Junfeng, Du Jian, Hong Xiaoqiang, Zhao Junxing, Liu Mandao, Zhang Xingliang, Xia Zhiming, Wang Cheng, Jia Tao, Zhang Yueli, Hu Sen 2006, 22 (10):  141-141.  Abstract + ( 1388 )   In accordance with the theory of agricultural ecology and the requirements of water-saving technology, drought-resistant cotton varieties were comprehensively examined at different plant densities and different basal nitrogen and phosphorous rates. The results of the three-year experiment indicated that compared with the yields at 45000 plants per hectare and 60000 plants per hectare, the cotton yield at 75000 plants per hectare increased by 671.85kg and 483.30 kg, or by 57.48% and 41.36%, respectively. Compared with the yield of Zhongmian 19(middle maturity), the yields of Shan 402(early maturity), and Shan576 (middle early-maturity) increased by 16.62 % and 16.1%, respectively. Compared with urea, diammonium phosphate increased cotton yield by 126kg and the two fertilizers at the rate ranging within 150~225kg per hectare increased cotton yield separately by 11.35% and 10.53%.

  Main Character and Cultivate Technology of Cotton Hybrid JiH239 Cui Ruimin, Geng Junyi, Wang Zhaoxiao, Zhang Xiangyun, Liu Suen, Liu Cunjing, Guo Baosheng 2006, 22 (10):  144-144.  Abstract + ( 1525 )   The main characters of new cotton hybrid JiH239 were analysed based on the results of Hebei Cotton Regional Test in 2003~2004. The results showed that JiH239 was high yield, disease-resistance and fiber length and strength were better than CK cultivar, micronaire value was a little high. The Bt toxic protein gene expression levels was higher than bollworm-resistant CK Zhongmiansuo41 in different growing period. The purity of bollworm-resistant was higher than Zhongmiansuo41 in seeding period and no significant variety in bud period and flower-boll period. The Cultivate Technology of this hybrid was suggested for planting.

  The Relationship between Leaf Color Threshold and Leaf Area Index at Heading and Light Intensity During Grain-filling Zhong Xuhua, Huang Nongrong, Zheng Haibo, Jiang Yuanhan, Roland J. Buresh, Peng Shaobing 2006, 22 (10):  147-147.  Abstract + ( 1576 )   Leaf color is usually used in the diagnosis of crop N status and leaf color threshold (LCT) is the basis for precise fertilizer-N application. The LCT is the optimum leaf color at which maximum grain yield is achieved. It has been reported that LCT is affected by the population size and the light intensity during grain-filling stage. The objective of this study was to determine the quantitative relationship between LCT and population size and light intensity during grain-filling. Four field experiments were conducted at Guangzhou during 2004-2005 early and late seasons. Yueza 122, a two-line hybrid rice, was arranged in eight fertilizer-N treatments. Leaf color (SPAD value), leaf area index (LAI) at heading and grain yield were measured. The results showed: (1) The LCT was different among the 4 seasons, varying between 39~45. The LCT can be derived conveniently and precisely from the quadratic curve with leaf color and grain yield being the independent and dependent variable, respectively. (2) The relationship between grain yield and population index (the product of SPAD and LAI) at heading was a quadratic curve. About 86% of variation in grain yield could be explained by leaf color, LAI at heading and sunshine hours during grain-filling. The optimum population index increased as sunshine hours increased. (3) There existed a quantitative relationship between LCT and sunshine hours and LAI. The LCT increased as sunshine hours increased, and decreased as LAI increased. The LCT for different locations and seasons might be estimated if sunshine hours and LAI were available.

  Genetic Improvement and Utilizition of Tang Si Ping Tou Maize Germplasm Gao Xiang, Cao Shaoshu 2006, 22 (10):  154-154.  Abstract + ( 1254 )   Since the 1970s of.20th century ，the lack of the new germplasm with high quality, resistance to manifold stresses, high combining ability and adaptability to extensive areas , became "bottleneck" influencing maize commercial breeding further developing. Inheritance frangibility of the germplasm applied in production caused prevalence attention，the amplification, improvement and innovation of germplasm became the most important work in maize breeding research. Tang Si Ping Tou maize germplasm played a gigantic role in China maize breeding and production. Hence, it was extraordinary necessary for maize breeder to thorough understand，master and utilize Tang Si Ping Tou maize germplasm. These were able to lie the foundation to continue to use existent representative heterosis pattern and establish new heterosis pattern in the new century, and with all-important practical and far-reaching historic significance.

  Analyzes and Forecast of Cotton Yield of Hebei Province with Grey System Zhang Wenying, Li Yuqin, Wang Youzeng 2006, 22 (10):  158-158.  Abstract + ( 1221 )   For knowing ordinary varied regular of cotton yield of Hebei province and making clear aim and prospect of breeding in the future, he used the model of GM(1,1) of grey system through analysis regional experiment yield of cotton varieties which were approved by Hebei variety committee. a predictable model of the occurring of cotton`s develope: ^X(1)(k+1) =38965.718385e 0.024221-37990.718385 was formulated, Model to forecast the cotton produce of Hebei province production under the conditions of relative stability of all its relevantelements and to provide scientific information for production planning and decision making. The overall aim of cotton breeding which optimized structure of variety and quality was maked clear, it was keeping advantage of seed selecting medium count yarn variety and paiying attention to seed selection long-staple and short-staple upland cotton of shortage in market.

  The Primary Study on Multifactor Evaluation of new Flax Varieties with Method of DTOPSIS Du Gang,, Liu Qining, Zhao Zhenling, Wu Xueyin 2006, 22 (10):  161-161.  Abstract + ( 1500 )   In order to accurately and availably multifactor evaluating of new flax varieties, the paper primarily study the method of DTOPSIS to summarizing and valuing new flax varieties with flax regional test in Yunnan province in 2004 to 2005 as example, and the method contrasts with only to evaluation from yield. The experimentation indicates that the results of differ with yield. The result is more reasonable with the method than traditional variance analysis, and it is very good application value to multifactor evaluation of new flax varieties. In addition, some problems about using DTOPSIS to multifactor evaluation of new flax varieties was discussed in this paper.

  目次

  Report on The Crossbreeding of The Glutinous Corn cultivars “Yinnuo No. 1” Sun Yizhen, Yu Tongquan, Liu Yufen 2006, 22 (10):  165-165.  Abstract + ( 1315 )   “Yinnuo No. 1” is a hybrid of XN-5 and the BN51 self-cross strain. The Glutinous Corn Breeding Group of Beijing Agricultural College bred it in 2000 The cultivars had passed breeding tests in 2000 and 2001, yield comparison in 2002 and 2003, and regional tests in the Beijing area in 2004~2005. Fresh ear yield of “Yinnuo No. 1”, which is up to 720 kg/(660m2), is 30.8% higher than that of the cultivars “Zhongnuo No. 1”, that of fresh grain being 20.7% higher. “Yinnuo No. 1” is the only one yellow-grained glutinous corn cultivars passed regional tests in the Beijing area.

  农艺科学

  Expression and Analysis of Weak Gluten Wheat Varieties in Jiangsu Province Wu Hongya, Zhu Dongmei, Zhang Boqiao, Gao Derong, Cheng Shunhe 2006, 22 (10):  169-169.  Abstract + ( 1143 )   Jiangsu Province, the largest priority industrial area of weak gluten wheat in China, possesses its particular advantage in production and new variety breeding. Seeking for a breakthrough in weak gluten wheat breeding, main problems concerning weak gluten wheat in Jiangsu Province such as significant changes in quality with varieties and planting environments, higher protein and wet gluten contents and instability among years, and relationship between high-quality and high-yield were discussed in this paper. And ideas of breeding weak gluten species with high-standard qualities and stable indexes and popularizing quickly the utilization of solvent retention capacity (SRC) in breeding new variety were also proposed.

  Study on Variety Regional Test of Burley Tobacco Shang Zhiqiang 2006, 22 (10):  173-173.  Abstract + ( 1303 )   In order to select quality Burley tobacco varieties, which were appropriate for planting at different production district, the field comparison test of 7 selected varieties were conducted and their agricultural and economic character, disease resistance were analysized. The agricultural character results showed that the plant height were higher than that of CK besides B6, B7.The plant height of B2 was the highest. The leaf number of 7 varieties were average 21.31 respectively, which were less than that of CK. The growing stage of all varieties had no significant different, which were middle maturing variety. The disease index of B2, B5 for TMV were 41.07and 31.70, and resistance of them was MR. The disease incidence B6 black shank was highest in the rosette stage,and the disease incidence B7 black shank was highest in the mature stage. The first-class tobacco proportion of B5 was highest. The yield of B1 was highest, and was bigger than that of CK. The yield of B5, B3 was second and third respectively. The output value of B5 was the highest .B3,B1 had better total characteristics so were consider primarily to be quality Burley tobacco varieties, which appropriated for planting at BinChuan.

  The Analysis of Raw Cotton Fiber Quality between Region and Year in China Tang Shurong, Xiao Yingnan, Yang Weihua 2006, 22 (10):  177-177.  Abstract + ( 1254 )   China is one of the biggest cotton producing and consuming countries in the world, its total yield and consuming quantity accounted to 25 percent in the world. China is presently faced with the fierce competitions from other cotton producers in the world because of the decreasing of the tariff and the increase of importing raw cotton allocation. In order to investigate the competitive ability of cotton production in China, fiber quality datum of cotton sample for commercial planting varieties from 13 main cotton producing provinces in 2001 to 2005 were analyzed in the paper to understand the distribution of eight fiber quality characters, including fiber length, fiber strength, fiber length uniformity, micronaire, et al. in the Tenth Five-year Plan period, and the correlation between the fiber quality characters was also analyzed through STATA statistics method. It indicated that cotton fiber length mainly ranged from 28 to 29 mm, fiber uniformity index from 82 to 84%, fiber strength from 27 to 29cN/tex, micronaire from 4.0 to 5.0 in China in the Tenth Five-year Plan period, which shows it can satisfy the need of the spinning industry for middle and low spinning. fiber quality changed with the year. According to ecosystem area, the Yangtze River Region had longer, stronger and more uniformity fiber than the other regions, the Yellow River Region and Northwest inland Region, but higher micronaire, worse color, lower grade than other regions. Fiber length, fiber strength, fiber length uniformity, micronaire and color grade for the Yellow River Region is no more than the other ecosystem area. The Northwest inland Region had best micronaire, color and grade. Statistics analysis showed that the correlation coefficient between fiber length and strength is also remarkable(r=0.7156). The relationship between fiber uniformity index and strength is also remarkable(r=0.5300). and significant positive correlation between spinning even index with Fiber length, fiber strength, fiber length uniformity. Compared with Uster official bulletin, fiber Synthetic quality in China reached to middle quality level in the world.

  Review on Grain Yield and Major Agronomic Characters of Single Season Middle Maturity Hybrid Rice in Sichuan Lv Jianqun, Zeng Xianping 2006, 22 (10):  184-184.  Abstract + ( 1663 )   By analyzing 116 group data collected from 86 new single season middle maturity hybrid rices developed in Sichuan for Provincial Yield Trials during 1996 to 2005 with the Coefficient of the correction and path analysis, the result indicated that there exist significant positive correlation between spikelets number of per panicle (SNPP) and filled grain number of per panicle, the ratio of seed setting (SSR) and grain yield, respectively. And the contribution of effective panicle number (EPN) to grain yield is most, but the indirect action of EPN by spikelets number of per panicle is also more, so only increased EPN is not entire to improve grain yield. The authors suggest that breeding for hybrid rice with high yield in Sichuan should follow the way of increasing filled grains per panicle and 1000~ grain weight, as well as balancing the relationship of those characters through establishing hybrid rice population projected. The yield component traits at 9.0t/hm2 should be: effective panicles number (EPN) 2.65~2.70million/hm2, SNPP180~200, SSR>84%, and 1000 grains weight 27~29g.

  植物生理科学

  Relation of Ferricyanide Reductase and Transfer of Proton and Potassium Across Plasma Membrane in Fresh Roots of Wheat Hua Dangling, Yang Qiuyun, Tan Jinfang, Jie Xiaolei, 2006, 22 (10):  187-187.  Abstract + ( 1381 )   In order to study the relation of ion absorption and Ferricyanide reductase,compare the differential of several wheat cultivars, hydroponics and short-term uptake tests were undertaken. Ferricyanide reductase was detected in wheat root, and there exist difference in activity of Ferricyanide reductase among wheat cultivars. Whether Ferricyanide added or not to reaction solution, the roots of all wheat cultivars could brought about pH change because of the transfer of potassium and proton across plasma membrane of roots, moreover, the existence of Fe(CN)63- as the reaction substrate to Ferricyanide reductase enhanced the degree of pH change. The deoxidization of Fe(CN)63- influenced on the uptake/exudation of potassium across plasma membrane of roots, and with different effects on different cultivars. Ferricyanide reductase have an effect on ion transport across cell membrane,and with different effects on different cultivars.

  Distribution Analysis of Chloride and Sulfur in the Tobacco Plantlet Tan Zhongxia 2006, 22 (10):  192-192.  Abstract + ( 1237 )   The distribution of chloride and sulfur in the tobacco plantlets was analyzed by correspondence analysis method. The flued-tobacco was made up in 2002 at Yunnan Honghe tobacco factory. The results showed that chloride and sulfur distributed from the upper to the lower position in the tobacco plantlet, no obvious regulation was observed. But the correspondence analysis can demonstrated the relation between tobacco leaves position and the distribution of chloride and sulfur.

  Effect of Plant Growth Regulators and Potassium Level on Tobacco Growth and development Liu Zhongyang,, Liu Fang, Jie Xiaolei,, Hua Dangling, Han Fugen, Liu Shiliang 2006, 22 (10):  195-195.  Abstract + ( 1427 )   The paper studied the effect of top pruning and plant growth regulators on the tobacco growth and development under different potassium level by pot trail. The results showed that: plant growth regulators could increase the value of plant’s truck height, stem circumference, the maximum leaf area, section distance, root volume, fresh root weight and area of the second leaf, the BR and GA3 was more better, but there was no significantly effect on tobacco’s effective amount of leaves. There were no significantly effects of applied potassium in higher level on tobacco plant’s truck height, stem circumference, the maximum leaf area, section distance, fresh root weight and area of the second leaf, but could significantly effect on root volume increase.

  Influence of NaCl and KNO3 treatment on pepper seed germination and isoenzyme activity Hu Neng hing, Zhang Zi xue, Cui Guang rong, Zhang Cong yu, Sui Yi hu 2006, 22 (10):  199-199.  Abstract + ( 1779 )   Influence of different concentration of NaCl and KNO3 treatment on 4 kinds of pepper seed germination and its isoenzyme activity was studied. The results showed that pepper of different kind made obvious distinction in germination percentage ,viability ,index and activity of POD,SOD, in which Tianying and reforming string-pepper 8819 were in higher level. Tianying showed contrary tendency of germination percentage when treating by NaCl and KNO3 .Chunyu got 71.4%, the biggest germination percentage by 0.3% KNO3 treatment, and distilled water could accelerate reforming string-pepper 8819 germination. Comparing to CK, POD isoenzyme bands of 4 kinds of pepper improved and dyed deeper ,and under NaCl treatment, SOD isoenzyme bands was brighter than by KNO3 ,which indicated that NaCl could enhance SOD isoenzyme activity remarkably.

  目次

  Drought Resistance of Camelina Sativa (L. ) Crantz’s Seeds in Germination Cui Jiang, Jiang Wei, Sun Qun, Sun Baoqi 2006, 22 (10):  203-203.  Abstract + ( 1465 )   The germination rate, germination index and seedlings’ proline content of Camelina sativa were compared with wheat (Jing 411) in this paper, the results are as follows: during treatment of the seeds with PEG, as PEG concentration was increased, germination index and seedlings’ length of Camelina sativa’s decreased more slowly than that of wheat，proline of wheat increased more than that of Camelina sativa, which indicate that wheat is more sensitive and less resistant to drought than Camelina sativa. The seed of Camelina sativa contain 5.67% jelly which envelopes the seed and could absorb 181.31 times water. This might be the main cause that the seeds of Camelina sativa absorb more water in more rapid speed than wheat, which can explain the drought-resistance of Camelina sativa.

  植物生理科学

  Nutritional Conidition Optimization of the Xylanase Production by Pleurotus nebrodensis Wu Ping, Yao Wu 2006, 22 (10):  206-206.  Abstract + ( 1259 )   The effects of different culture medium with different carbon sources, nitrogen sources and salt on the xylanse activity produced by pleutrotus nebrodensis were tested using DNS method. The results indicated that the best cultrural medium is 5% sugar cane residue, 2% soybean powder, 0.15% MgSO4, 0.3% KH2SO4%, 0.01% ZnSO4, and 2 tablets VB1. The highest xylanase activity was up to 60.50u/ml.

  目次

  Effect of Straw Residue Returned and Site-specific Nitrogen Management on Yield and Quality of Rice Xu Guowei, Wu Changfu, Liu Hui, Wang Zhiqin, Yang Jianchang 2006, 22 (10):  209-209.  Abstract + ( 1602 )   The annual total amount of crop residue straw exceeds billion tons in China. However, about 45%~60% of them are burnt or discarded, which not only wastes organic fertilizer source, but also pollutes the environment. Meanwhile, heavy use of nitrogen fertilizer has become a serious problem in rice production in this country. The purposes of this study were to investigate the effects of wheat straw incorporation to soil and site-specific nitrogen management (SSNM) on grain yield and quality of rice. With Yangjing 9538 as a material, rice yield and quality were evaluated under straw residue returned and different N management. The results showed that the yield was increased with all straw residue returned and lower nitrogen input. Stems and tiller numbers were decreased; spikelets per spike and ripened grains were improved under straw residue returned and N management (SSNM, applying nitrogen based on the timing, amount of nitrogen and values of chlorophy11 meter). The differences in the milling quality and nutrient quality of rice were not significant between straw returned and straw removed. Grains from the technique (straw residue returned and N management) had lower chalkiness and amylose content, longer gel consistency, indicating that appearance quality and cooking quality is improved. Peak viscosity and breakdown value were increased and setback value decreased under the technique, also suggesting that the eating quality of the rice grown is advanced. As the same, this technique promotes carbon remobilization from culms and sheaths to grains and NSC (non-structural carbohydrate) residue in the stems at heading stage increased, the reversed result was observed at maturity. The results showed that ATPase activity in the grains photosynthesis ratio and root activity were also improved in the process of grain filling under the technique. Reasons for the differences in the formation of grain yield and quality were discussed in the paper.

  土壤肥料科学

  Effects of Different Cake Fertilizer Amount on Yield and Quality of Flue-cured Tobacco on Soil of Different Organic Matter Contents Yi Jianhua, Zhang Xinyao, Li Tianfu, Pu Wenxuan, Yuan Shihao, Liu Weiqun, Yang Yuhong 2006, 22 (10):  216-216.  Abstract + ( 1314 )   The field experiments were carried out at different organic matter content soils at Huaning county, the result showed that: In the soil of organic matter content less 2%, the rate of supper tobacco was raised notability and quality was ameliorated by applying cake fertilizer. If organic matter content greater than 2%,the rate of supper tobacco was not raised notability by applying cake fertilizer. At present, chemistry fertilizer was applied plenty, organic fertilizer can reform physics capability of soil, create satisfactory association texture, enhance soil microorganism activity; in the soil of organic matter content less 2%, 20~30kg/mu cake fertilizer can enhance yield、quality and the rate of supper tobacco. If the soil have high organic matter contents (≥2%), it should apply less or no cake fertilizer.

  目次

  The Effect of Ecological Active Organic Fertilizer applied on Vegetables and Fruit trees Zhang Lijuan, Wang Shuzhen, Li Xin, Li Yumin, Li Baohui 2006, 22 (10):  221-221.  Abstract + ( 1373 )   This study was carried out the experiment of the ecological active organic fertilizer (EAOF) applied on vegetables and fruit trees. The results showed that: (1) the application active organic fertilizer was good to facilitate the growth of Chinese cabbage. With three measurements, the plant height，the number of leaves, the plant width and plant expansion development treated by active organic fertilizer were higher than that treated by the conventional fertilizer (CF). Compared to the treatment of CF, the yield treated by EAOF increased as 334 kg/667m2, the increase ratio reached to 10.96%, and the benefit ratio was 1:6. The capability of disease resistance increased 5.6% treated by EAOP, generally decreased 2.9%; (2) the quality of tomato was significantly improved by the treatment of EAOF. In detail, the total number of tomato increased as 14% compared to the treatment of CF, small fruit reduced to 4%, and big fruit and middle fruit increased as 2%, 1.9%, respectively. The content of fruit soluble solids was 3.1 % higher than the treatment of CF; (3) compared to the application of compound fertilizer, the weight of 100 fruit and average yield per plum were improved by the application of EAOF，which were 11.1%, 22.7% higher, respectively. The result also showed that, with the application of EAOF, the total acidity of the plum reduced to 0.1%, the contents of Vc and the soluble solids were improved as 0.2 mg/100g and 2.1%, respectively. There were no difference in the fruit rigidity.

  土壤肥料科学

  Effects of Nitrogen Application on the Forming and Accumulation of Starch and Its Compositions of Spring Maize Chen Yang, Zhao Hongwei 2006, 22 (10):  225-225.  Abstract + ( 1359 )   The effects of nitrogen application on dynamic changes of starch and its compositions and ratio of amylopection to amylose in grains of spring maize (high starch maize SIDAN19, common maize NEAU250, good quality protein maize FENGHE10) were studies in field experiment. The results showed that contents of amylopectin, amylose and total starch went up in spring maize grains after spinning. The highest total starch content was found at the level of N200 in grains for all tested varieties, the highest amylopectin contents of SIDAN19 and FENGHE10 were found at the level of N200 in grains, SIDAN19 was the best tested variety at this aspect of total starch and amylopectin contents. The amylose content of FENGHE10 increased with the raise of nitrogen application, but the highest amylose content of SIDAN19 was found at the level of N200. The ratio of amylopectin to amylose fell gradually after spinning.

  Effect of Rice Straw Returning on Tobacco Field Soil Nitrogen Mineralization Peng Yu, Yi Jianhua, Pu Wenxuan, Zhang Xinyao 2006, 22 (10):  230-230.  Abstract + ( 1545 )   Incubating trials in lab and field were carried to study the effect of long-term returning rice straw on the characteristics and processing of soil organic N mineralization in tobacco field. Lab trials proved that long-term rice straw returning had a positive effect on the soil organic N mineralization with improved potential and rate. The mineralization potential of the 6-years returning soil was 92.11 kg/hm2, and was 23.78% greater than that in the non-straw returning. Compared with control, the rice straw returning could advance the soil N mineralization. The net mineralization in tobacco growth period increased by 17.67% and 15.30% by the rice straw returned 5-years and 1-year respectively. In the tobacco field soil incorporated rice straw, the amount of soil inorganic N was enhanced and effected the soil N mineralization positively during the middle and late growth period of tobacco. The soil microbial biomass N in straw incorporating soil was 20.18% greater than that in the non-straw incorporating at beginning of transplantation, and was 40.71% greater at ending of harvest stage. The soil microbial biomass N in rice straw returning soil alternate during the first year and did not be stable at a new level.

  Effects of Different Agricultural Practices on Rhizosphere Soil Microbe Floras in Soybean Field Guo Yongxia, Li Caihua, Jin Xuehui 2006, 22 (10):  234-234.  Abstract + ( 1423 )   After different agricultural practices were used in soybean field, the population of soil microbes and fungal flora structure were tested in different growth period. The result showed that using organic manures or straw returning can increase the population of bacteria and actinomyces, decrease the population of soil fungi; Using chemical fertilizer only can increase the population of soil fungi; Under the same condition of using chemical fertilizer, no-tillage and deep-tillage are not good for reproduction of soil microbe; Continuous cropping can worsen the ecosystem of soil microbes.

  Effects of the Quantities of Nitrogenous Fertilizer on the Yield and Population Quality of the Mid-gluten Wheat Yangmai 11 Huang Yanshuai, Zhang Hongcheng, Xu Ke, Li Bingsheng, Qian Jian 2006, 22 (10):  238-238.  Abstract + ( 1630 )   The study is to provide scientific base for high production of mid-gluten wheat with certain applying amount of nitrogen fertilizer. Effects of the quantities of nitrogen fertilizer on the yield and population quality of mid-gluten Yangmai 11 are studied in the experiment. The results indicate that on the condition of the ratio of 5:5 between basal N and top dressing N, the nitrogen applying on the shooting stage and the suitable applying amount of nitrogen fertilizer of 225~281.25kg/hm2, the yield and the overall applying quantities of nitrogen fertilizer show conic relation and it can get higher grain yield, ratio of fertile tillers, the max LAI and biomass of ripping period.

  园艺园林科学

  Landscape Characters of the main species of Malus and Chaenomeles Resources and Their Application Lin Na, Jiang Weibing, Weng Mangling 2006, 22 (10):  242-242.  Abstract + ( 1464 )   The main species of Malus and Chaenomeles , usually regarded as“the most gaily-colored flower of the country”, are one of the traditional famous flowers in China , with many species, a long use history and deep cultural connotations. In present, the tree species resources of Malus and Chaenomeles have not been systemically assorted，and only a few traditional species and varieties are applied in landscape architecture, the utilizing ways are fewer. According to the relative literature, this paper surveys the taxonomical adscription, the main botanic characters and ornamental characters of the Malus and Chaenomeles species which have been used or have potential applied value in landscape architecture, summaries the expressional forms of their culture, states their disposition and applied forms in the classical and modern landscape, points out the problems that lie in the development and application of them in landscape, raises the exploitation measures and forecasts the application prospect.

  The Identification Index Screening in Field of Heat Tolerance for Radish Ran Mao-Lin, Song Ming, Yong Xiao-ping, Song Hua 2006, 22 (10):  248-248.  Abstract + ( 1357 )   Many indexes have been investigated in the research from exterior appearance to yield character of radish. After the filtration of those indexes, Four-heat tolerance index was put forward: fresh weight unit area of seedling, heat injury index, death rate of plant in summer, and effective root rate. Identification standard as follows: It is strong heat tolerance material if its fresh weight unit area in the seeding period(W/A)≥0.5g/cm2, middling heat tolerance material (W/A)for 0.2g/cm2-0.5g/cm2, feel heat material (W/A) for≤0.2g/cm2. Leaf heat injury index ≤10% is strong heat tolerance material, the heat injury index is 10%-30% belong to middling heat tolerance material, the heat injury index ≥30% is feel heat material. Death rate of plant in summer≤10% is strong heat tolerance material, 10%-20% is middling heat tolerance material, ≥20% is feel heat material. Effective root rate≥90% is strong heat tolerance material, 80%-90% is middling heat tolerance material, ≤80% is feel heat material. Death rate of plant in summer and effective root rate are two simple indexes of identification in the field, so it is extensive used for the first identification screening of large materials.

  园林园艺科学

  Comparison between Several Substrates on Soilless Culture of Tomato LI Shengli, Sun Zhiqiang 2006, 22 (10):  254-254.  Abstract + ( 1375 )   Five mixed substrates formula: rockwool, perlite:peat=3:2, slag:peat=3:2, peanutshell:vermiculite:perlite= 5:3:2 and corncob:vermiculite:perlite=5:3:2 are conducted in tomato soilless culture. The results are as follows. Bulk density of five treatment increases by different degree during cultivation. The growth properties, photosynsythesis , chlorophyll content , root activity and yield of tomato have significant difference among different formula. Fresh mass, dry mass and leaf area of tomato plant cultivated in peanutshell:vermiculite:perlite=5:3:2 reach 705.24 g/plant, 73.871 g/plant, 7654.5cm2/plant respectively, which have significant difference compared with control’s. The early yield of five treatment are lower than control’s, of which the treatment of slag:peat=3:2 gets higher early yield and it reaches 23859.0 kg/hm2. The treatment of peanutshell:vermiculite:perlite=5:3:2 gets the highest total yield(78210.0 kg/hm2), increasing by 23.9 per cent compared with control’s yield. The tomato cultivated in slag:peat=3:2 gets the highest sugar/acid (7.58) and cultivated in peanutshell:vermiculite:perlite=5:3:2 gets the highest Vc content(0.1015 mg/g).

  园艺园林科学

  Study on Culture Methods of The Wild Ground Cover Carex giraldiana in Beijing Shi Jinchao, Zhu Qijiu, Xie Youli 2006, 22 (10):  259-259.  Abstract + ( 1618 )   Culture methods of Carex giraldiana as one of the wild ground cover plants introduced from the mountainous area of Beijing were studied in this paper. Results shows that: (1) This plant can be propagated both by seeds and ramets. The preferable seeding time is Autumn and the rameting time is from March to a August. (2) Recommendable growing spacing in the rows is 30 cm×30cm and 3 plant in one bunch . (3) This plant is suitable for ornamental lawn, but not for the sport lawn as the trample resistant ability is weak. It is also a kind of good wild ground covering plant for the bio-slope-engineering that needn’t be pruned in maintenance.

  园林园艺科学

  Tissue Culture and Rapid Propagation of Prunus lannesiana Wils. Meng Yue’e, Li Yanmin, Zhao Xiushan, Wang Huijuan 2006, 22 (10):  264-264.  Abstract + ( 1321 )   The tissue culture and rapid propagation of Prunus lannesiana Wils was studied in this paper.The results showed that the optimum medium for propagation was MS/ML + 6-BA0.5mg/L + NAA 0.05mg/L + sugar 40g/L + agar 4.5 g/L, and the ratio of proliferation was 2.47~2.56;Shoots were rooted on the medium ML + IBA 0.05 mg/L + NAA 0.05 mg/L +sugar20g/L +agar4.5g/L,and the rooting rate was 100%;Being acclimatized for 12~17d,the rooted plantlets were transplanted to turfy-soil ,the survival rate was 90%.

  Two Kind of Slow-release Fertilizer Influence On The Golf Green Grass In ShenZhen Fei Ling, Gan Youmin, Liu Yuan 2006, 22 (10):  267-267.  Abstract + ( 1834 )   Base on mensurating and comparing about grass growth speed、variance of the green rates and burning spot after using two grain size and raw material slow-release fertilizer on the two golf Green in Shenzhen,we can know IBDU fertilizer has bigger grain size and shorter effect period,on the other hand ,it can enhance the growth of the Green grass quickly than UF fertilizer .In short ,IBDU fertilizer can apply to the golf Green in the north or cool region,but UF fertilizer is fit for the golf Green in Shenzhen and peripheral region.Speed text have done in six Greens with 4.2mm,4.5mm,5mm separately, which recommend hold height 4.5mm in common match and hold height 4.2mm in title match by according to USGA Green speed standard.

  目次

  Screening Chilling-Resisted VAMFs and Their Effect on Resistance of Eggplant to Chilling Bai Suhua, Dong Chaohua, Liuxin 2006, 22 (10):  272-272.  Abstract + ( 1542 )   To screen chilling-resisted VAMFs, six VA moycorrhizal fungi(VAMF) strains were selected from 302 spores among 37 soil samples got from crop roots in different regions, and named G.sp1, G.sp2, G.sp3, G.sp4, G.sp5, G.sp6. All of them show chilling resistance and higher infect rates. Among them, G.sp2 show much higher chilling resistance than the others. Inoculated with sx VAMF strains, HEIXING long eggplant was treated by low temperature of 8℃.Then, electrolytic leakage, content of molondialdehyde(MDA),activity of superoxide dismutase (SOD), catalase(CAT), peroxidase(POD) and content of soluble sugar of eggplant were measured. The result showed that all six strains can protect cell membrane structure ,improve physiology metabolism and promote chilling resistance of HEIXING long eggplant. Six eggplant cultivars were inoculated with G.sp2 and the infect rates ,chilling index(CI), electrolytic leakage, content of molondialdehyde(MDA), activity of superoxide dismutase (SOD) were measured. The results showed that G.sp2 can efficiently infect all six cultivars and remarkably promote their chilling resistance. So, G.sp2 is strong chilling resistance strain.

  园艺园林科学

  Content and Chemical Composition of Carotenoids in Persimmon Fruit Yuan Bing, Xu HuaLong, Leng Ping 2006, 22 (10):  277-277.  Abstract + ( 1497 )   Persimmon fruits harvested from different coloring period were used to extract carotenoid and then the extracted carotenoid was treated with saponification. The pigment sample was analyzed through HPLC in terms of characterization and quantification. The results showed that pigment in persimmon fruit of collection period was mainly made up of zeaxanthin, β-cryptoxanthin, β-carotene, Lutein and Lycopine. There was almost no difference in terms of carotenoid composition between peel and flesh, but the ratio was different. The total content of carotenoid in peel was about six--eleven times more than that in flesh. The maximum composition was zeaxanthin, β-Cryptoxanthin was the next, and the third one wasβ-carotene in peel. While the maximum composition wasβ-cryptoxanthin, Zeaxanthin was the next, and the third one wasβ-carotene in flesh. It showed that primary component in flesh isβ-Cryptoxanthin and the accumulation of β-Cryptoxanthin in persimmon fruit was influenced by temperature.

  Study on the Karyotypes in Populations of Lilium concolor Salisb. Wang Xin, Lei Jiajun, Li Mingxu 2006, 22 (10):  281-281.  Abstract + ( 1375 )   The karyotypes of 4 populations of Lilium concolor Salisb. were studied. The results showed that the karyotypes of L. concolor var. buschianum Baker. (BH27) and L. concolor var. buschianum Baker. (BH41) were 2n=2x=4m(2SAT)+4st+16t(2SAT) and 2n=2x=4m(4SAT)+12st+8t(4SAT), respectively. The karyotype of L. concolor var. concolor f. coridion Kitag. (BH20) was 2n=2x=4m(4SAT)+4st+16t(4SAT) and that of L. concolor var. megalanthum Wang et Tang (BH50) was 2n＝2x=4m(4SAT)+6st(2SAT)+14t(4SAT). The karyotypes of all the 4 populations were 3B. There were a few variations in the karyotye formulas, relative length, arm ratio, secondary constitution number and its distributions among the 4 populations.

  Effect of Salicylic Acid (SA) on Chilling Resistance of Germinating Cucumber Seeds Shu Yingjie, Zhou Yuli, Zhang Zixue, Sui Yihu 2006, 22 (10):  285-285.  Abstract + ( 1561 )   Effects of different concentrations SA solution (0.00g/L、0.01g/L、0.05g/L, 0.1g/L、0.15g/L、0.2g/L) on chilling resistance of germinating cucumber seeds were studied. Results showed that all concentrations SA solution could enhance germination rate, germina

  目次

  Effect of Root Separation on Nutrients Uptake and Occurrence of Leafminer of Wheat under Wheat-Fababean Intercropping Li Yongjie, Chen Yuanxue, Tang Li, Li Shaoming, Zheng Yi 2006, 22 (10):  288-288.  Abstract + ( 1477 )   A pot experiment was conducted to study effects of root separation on fababean growth, nutrients uptake and occurrence of leafminer in wheat and fababean intercropping. The results showed that fababean shoot biomass and the amounts of N, P, K uptake were higher without root separation(I) than those with both mesh separation(M) and solid separation(P). In different growth stages there were notable discrepancy levels between P and I at P<0.05. Root separation still affected occurrence of leafminer of fababean. The wheat leafminer was I

  植物保护科学

  Study on the Differences between the Inhibitions of Biocontrol Bacterium Strain ANTI-8098A (Bacillus cereus) against Ralstonia solanacearum-Virulent and Avirulent Strains Ge Cibin, Lin Kangmei, Zhu Yujing, Su Mingxing, Liu Bo 2006, 22 (10):  293-293.  Abstract + ( 1488 )   The inhibitions of the biocontrol bacterium strain ANTI-8098A (Bacillus cereus) against Ralstonia solanacearum virulent strain F-01-V and avirulent strain F.1.3-010602-01-A were investigated and streptomycin was used as control. The results showed that the inhibition of strain ANTI-8098A against strain F-01-V was strong. There was a positive correlation between the inhibiting rate and the bacteria number of strain ANTI-8098A. The inhibition of strain ANTI-8098A against strain F.1.3-010602-01-A was weak. The inhibiting rates of the culture of strain ANTI-8098A with the bacteria number 20.0×108 cfu/ml against strain F-01-V and strain F.1.3-010602-01-A were 99.5% and 14.7%, respectively. Streptomycin could inhibit the growth of strains F-01-V and F.1.3-010602-01-A. There was a positive correlation between the inhibiting rate and the concentration of streptomycin. But the inhibition of streptomycin against strain F.1.3-010602-01-A was greater than the inhibition against strain F-01-V. The inhibiting rates of streptomycin with the concentration of 0.25 U/ml against strain F-01-V and strain F.1.3-010602-01-A were 3.3% and 50.0%, respectively. The field experiment on controlling the bacterial wilt disease of eggplant indicated that the strain ANTI-8098 reduced eggplant wilt severity by 92.11%, which was significantly higher than that with 72.81% using streptomycin. The results provided evidences for explaining the attenuation of strain ANTI-8098A against R. solanacearum.

  目次

  The Insectici Activities of Crude Extracts from 6 Medicine Plants Against the Larvae of Yponomeutidae evonymellus L. Jiang Ni, Miao Jianhua, Xie Baoling 2006, 22 (10):  297-297.  Abstract + ( 1663 )   Six medicine plants crude extracts were used to test the insectici activities against the larvae of Yponomeutidae evonymellus L. in laboratory. The results showed that the insectici activities of the extracts from roof of Phytolacca acinosa Roxb. is higher than other plants’. The stomach toxicity of Phytolacca acinosa Roxb. against the larvae of Yponomeutidae evonymellus L. reached 72.73% within 72h, and the growth inhibition rate was 72.08%. The result also showd that the extract of Yponomeutidae evonymellus L also have some contact toxicity agaist the larvae . All results indicated that Yponomeutidae evonymellus L is worth to study and exploit.

  植物保护科

  Isolation and Identification of Endophytes from Hippophae Li Qi, Sun GuangYu 2006, 22 (10):  300-300.  Abstract + ( 1488 )   Plant, endophytes are found widely in all kinds of plants studied, there are collaboration with the evolutionary process and mutual symbiotic relationship between plants and endophytes In this study, 327 endophytic fungi were obtained from roots, stems and leaves of hippoppae, and were identified as genera including Alternaria, Penicillium, Rhizopus, Cladosporium, Chaetomiam, Aspergillus, Pestalotia, Basipetospom, Acremonium, Cephalosporium and unknown species.Some endophytic strains showed differences in organ specializations.

  目次

  Research on the Occurrence Regulation and Control Technology of Psylla chinensis in Organic Pear Orchard Pan Chengjie, Du Xiangge， 2006, 22 (10):  303-303.  Abstract + ( 1211 )   Base on the organic pear orchard in region of Beijing, study the Psylla chinensis characteristics and its occurrence regulation. on this foundation，the key techniques of management methods, such as agriculture and Plant Pesticide control have been studied. In mid- March and mid- May when the Psylla chinensis adults of the generation of winter and the first generation become richer, foundation function had been done when several control measures had been carried on to prevent the pests. through adjusting to the orchard ecosystem and then can basic control them in the following months.

  食品科学

  Effect of Different Flour on Fresh White Salted Noodle Color Yang Ennian, Cheng Dongsheng, Lan Jing, Huang Sidi, Zou Yuchun﹡ 2006, 22 (10):  306-306.  Abstract + ( 1352 )   In order to understand the effect of starch, gluten and malt on fresh white salted noodle color, 8 different flours were prepared to make Chinese white salted noodles, then tested their L*、a*、b* values with Minolta at 0 hr and 24 hr, respectively. Analysis of ANOVA for L*、a*、b* values showed that all F-values were significant at 5% or 1% level. All noodle colors changed at 24 hr, their L* values (white-black) decreased, a*(red-green)、b*(yellow-blue) values increased. The result also showed that white salted noodle colors made by wheat flours added starch were better, and flour added 9% starch was the best. Result suggested that wheat breeder should breed new varieties with not higher gluten content, but higher starch content, good noodle color stability and resistant pre-harvest sprouting.

  目次

  The Dynamic Qualities Change Medel for Banana Ripened with Ethylene Zheng Mingfeng, 2006, 22 (10):  311-311.  Abstract + ( 1677 )   With the quadratic general rotational design,the effects of ethylene concentration, ripening temperature and time on the contents of chlorophyll in banana(Musa nan acv.Baxi) pericarp, the contents of soluble solid and starch in the pulp were investigated. The results show that the influence of ethylene concentration on the chlorophyll degradation was of significance(p<0.01), whereas of insignificance(p<0.05)on the changing of the contents of soluble solid and starch in the pulp.The influence of ripening temperature on the banana whole quality was of significance(p<0.01). The regression models of ethylene concentration, ripening temperature and time to the banana whole quality owned confidence levels above 95%.

  食品科学

  The Study of the Microwave-Assisted Extraction of Naked Oat Bran β-Glucan Shen Ruiling, Dong Jilin, Wang Zhangcun 2006, 22 (10):  316-316.  Abstract + ( 1397 )   The suitable extraction technique for water-solubleβ-glucan from ShanXi naked oat bran was obtained by microwave assisted extraction(MAE). Effects of the water/oat bran ratio，microwave power, microwave treat time and extraction pH of β-glucan were investigated and the corresponding extraction parameters were also optimized by orthogonal test. The optimum extracting conditions were obtained as follows: the water/oat bran ratio 12, microwave power 720W, extraction time 12min and pH 10.0,the yield of β-glucan was 8.31% on the condition.

  Study on Variation of Physics and Chemistry Index During Pile-Fermentation of Puerh-Tea Liang Mingzhi, Xia Lifei, Chen Linbo, Fang Chenggang, Duan Zhifen, Chen Jiwei, Yang Shengmei, Sun Rongqin 2006, 22 (10):  321-321.  Abstract + ( 1817 )   The variations of physics and chemistry index during pile-fermentation of Puer-tea were studied using sun-dry tea as raw material. The results showed that with turning pile, water content of tea sample reduced, and the pile temperature rised (middle strata>lower). The levels of catechins, thearubigins(TR), water-soluble carbohydrates, amino acids, polyphenols, proto-pectin and water extracts were decreased, while the contents of theabrownin(TB), water-soluble pectin, theaflavins(TF) and Caffeine were increased, among which catechins and thearubigins(TR) obviously reduced, and theabrownin(TB) and water-soluble pectin were greatly increased. From these, it indicated that the speed of transform is upper strata>middle>lower. All these provided some certain technological support for improving manufacturing methods and stabilizing quality.

  Effect Research on Rice Milling Quality of Dry-cultivated Shi Yingyao, Huang Yanling, Wang Weigang, Shen Guangle, Chen Duopu 2006, 22 (10):  326-326.  Abstract + ( 1199 )   With the material of 150 new varieties of dry resistance gene convergent cross generation, the milling quality diversity and correlation are analysed between dry-cultivate and water-cultivate. The results are as follows: dry-cultivate lower the rice milling quality, lower the head rice most, then the milled rice, lower the brown rice slightly. With the increasing of brown rice and milled rice, the diversity of dry-cultivate and water-cultivate becoming more. The head rice diversity is relatively stable. From the results we can see there are some variety lines has good dry resistance, their dry-cultivated milling quality are equal or better than that of water-cultivated. And those lines normally has good dry resistance. They can be used to use widely.

  Determination of 2,4-Dichlorophenoxyacetic Acid Residue in Orange by GC with Pre-column Derivatization Yang Ting, Lu Xiaohong, Huangfu Weiguo 2006, 22 (10):  330-330.  Abstract + ( 1497 )   For effective detecting of 2, 4-Dichlorophenoxyacetic Acid (2, 4-D) residue in orange fruit, a quick analytical method was developed. After extracted by acidic acetonitrile, the filtrate was purified by acid diatomite. The target compound in sample was derivatised by Trimethylsulfonium Hydroxide (TMSH), and then determined by GC-ECD. The results suggested that the lowest detection limit for 2,4-D was 5×10-13g, and the limit of quantification was 4×10-4mg/kg. The recoveries of 2,4-D from orange spiked with 0.001, 0.01, 0.1mg/kg ranged from 77.16 to 92.72%，with the coefficient of variation of 3.30 to 8.65%. This method is rapid, accurate, sensitive, and of good reproducibility．It can be used to determinate 2, 4-D in orange fruit.

  Analysis of Chemical Constituents of Volatile oil from Zanthoxylum Bungeanum Maxim in Hancheng by GC-MS Huang Sen, Liu Laping, Jia Li 2006, 22 (10):  334-334.  Abstract + ( 1870 )   The volatile oil from Zanthoxylum Bungeanum Maxim in Shaanxi Hancheng was distilled by vapor distillation–ether extraction. The chemical constituents of The volatile oil was analyzed by GC–MS. 80 compounds were separated from The volatile oil, among them 58 compounds have been identified. These compounds account to 93.83% of total volatile oil. The main chemical constituents are Limonene(25.58%); 3-Cyclohexen-1-ol, 4-methyl-1-(1-methylethyl)-, (R)- (13.38%); β-Myrcene(6.92%); γ-Terpinene(4.76%); β-Phellandrene(3.81%); Linalool(3.35%); 3-Cyclohexene-1-methanol, à,à,4-trimethyl- (3.28%); (E)-Ocimene (3.04%).

  The Quality Guarantee System on Green Food and Its Developmental Steps of Industrialization in China Chen Jikun,，Mei Weiyun 2006, 22 (10):  337-337.  Abstract + ( 2053 )   The paper to start with the concept, the developing idea, basic principle and necessary terms on green food were been stated. Moreover the six aspects on green food quality guarantee system in China have been presented: (1) to perfect the standards and regulations of the green food; (2) to standardize the quality attesting systems of the green food; (3) to set up the quality supervising systems of the green food; (4) to strengthen the technology support systems of the green food; (5) For green food, to set up and improve the supervision systems in place of production, the testing systems of product and the quality supervising and controlling systems of product in the whole course; (6) to strengthen the consciousness of the famous brand and to make a good management at trademarks on green food. Following above the writer put forward the developmental steps of industrialization on green food in China. They are: to strengthen the propaganda and public opinion supervision for to extend the influence on green food; to optimize the industrial construction for to expand the productivity scale on green food; to increase greatly support intensity of force in funds and to set up diversified investment mechanism; to increase greatly the force intensity in standardize and normalize on green food for to raise steadily the product quality; to strengthen the training and service in agriculture science and technology to make sure the production operate regulation of green food; to bring up and to open the market active for to realize the develop-mental of industrialization on green food; to create new science and technology to promote the industrialization development on green food by use to modern science and technology.

  Primary Research on Preparation of total oil Tea Saponins as reference Substance by dry column Chromatography Tu Yunfei, Du Xianfeng, Zhang Xuebo 2006, 22 (10):  343-343.  Abstract + ( 1547 )   Objective To establish a preparative method for total oil tea saponins as reference substance from the seeds of Camellia Oleiferal Abel.by dry column chromatography. Methods After raw material being extracted with 60 % ethanol, the ethanol extracts were evaporated to alcoholess under reduced pressure. And the solution was extracted by petroleum benzine. Then taking off the upper solution, and adding three times volume of BuOH for extracting, and this time the the upper solution was evaporated to dryness under reduced pressure. The dry powder was fractionated by dry column chromatography on silica gel (100~200 mesh) using the upper solution of EtOAc-MeOH-BuOH-H2O (2:1:4:7) as the eluent. The collected fraction was taken out by the Rf value, And then put the fraction into glass column to collecting the solution by using MeOH as eluent. After that evaporating MeOH with the solution to get the total oil tea-saponins, and decting the saponins by TLC (Thin-layer chromatography )and physical &chemical properties. Results The purity of the product quantitated by TLC was over 98 %. Conclusion The developed method is simple, rapid and the quantity of oil tea saponins also is more than normal preparation methods. All the results show that the praparation substance of all the oil-tea saponins should be as reference substance.

  目次

  Emergy analysis of cropping planting system based on farmers level A case of WuChuan County Li Chunyang, Qin Hongling, ChenYuanquan, Gao Wangsheng 2006, 22 (10):  346-346.  Abstract + ( 1415 )   The results of emergy analysis of different cropping system in Wuchuan County of Inner Mongolia under farmer view by using the emergy theory indicate that, the emergy input ratio and output ratio of cropping system are low level and should add output level; heighten the utilize ratio of renewable resource by strengthen the water saving because of the loading rate; The organically input overages the mineral input and we should increase assistant emergy to improve system production. The maize and rape has a exiguity higher proportion of yield emergy than other crops; we should increase the sowing area of maize and rape and decease the sowing area of potato according to the economics theory.

  生态农业科学

  Exploring Technology and Mode of Zoology Agriculture of Mountain and Hill Li Qilin,, Wei Chaofu, Wang Xianjun, Liu Guangde, Zhao Zhongjin 2006, 22 (10):  352-352.  Abstract + ( 1444 )   Mountain and hill belong to lag district of economic development and weak district of environment, and is abundant district of zoology agriculture in our country too. Recently construction and practice of zoology agriculture is got huge achievement in mountain and hill, and there are many technologies and modes that adapt to these areas are summarized. Spread of zoology agriculture must diversification, application must practice and research must science in mountain and hill. It is the importance of construction to generalize utility technology and match technology of zoology agriculture, to push industrialization of technology and mode of zoology agriculture, to optimize structure of zoology agriculture, to strengthen study of science and technology and adjust the energy sources of country in build of zoology agriculture of mountain and hill.

  三农问题研究

  The Analysis on Dominant Provinces of Cotton Production in China Liu Yanyan, Pan Xuebiao 2006, 22 (10):  360-360.  Abstract + ( 1238 )   The cotton is planted wide in China, and the suitability varies in different area. Based on the previous research, a series of six indexes，scale priority index, yield per unit priority index, concentrated degree index, comprehensive priority index, were chosen to analyze the predominance cotton production and its variation is included from comprehensive priority index and another two index about the ratio of cotton to crop between 1989 and 2003. It indicates that there are seven preponderant provinces of cotton production in China and Tianjin will probably become a new and developing one. In general, the predominance of cotton production is changing and decreasing in the east, while it is increased in the northwest.

  农业资源与环境科学

  Review on the Bio-ecology and Exploitation and Development of Savin(Sabina vulgaris) Plant Resource He Jun, Li Guangze, Chen Libiao, Zhang Xing,, Chen Cungen 2006, 22 (10):  365-365.  Abstract + ( 1363 )   Savin(Sabina vulgaris) is a shrub located in North China, which has a important function for protecting environment. It is also a important tree for city landscape construction in North China. In recent years, the savin plant has been found that has excellent insecticidal activity. A systematic research on insecticidal activity of the savin plant showed that it could be developed into botanical pesticide suitable for integrated pest management The paper reviews on the biology and ecology of savin, summarizes the development of research and application in the field of desert control, landscape construction and botanical pesticide. Furthermore, the problem between bio-ecology and plant resource of the savin pesticides has been analyzed and discussed, and a potent conceive scheme has been put forward for the integrate exploitation of savin plant resource.

  Current Situation and Protective Countermeasures of Eco-environment in Ningxia Rural Areas He Jing, Hu Jiajing 2006, 22 (10):  370-370.  Abstract + ( 1296 )   The eco-environment of Ningxia rural is very easy to be destroyed, and very difficult to father. Therefore, this text investigated and studied the environment current situations of Ningxia rural. Discovered that have some problems in Ningxia rural, such as sewage irrigate cause soil polluted; enterprises of villages and towns lead grave pollution; the use of fertilizer、 pesticide and plastic film result in pollution; The utilize rate of straw is very low and living garbage disposal rate is not high. For these problems, the text put forward some countermeasures. Such as reinforce management of agriculture water source and the region of sewage irrigation and enforce whole process management of the produce, transport, sell of fertilizers and pesticides; continue develop multi-use of straw in order to improve the use rate of straws; develop agriculture models that fit Ningxia conditions; raise money that accelerate the construct of environmental protect industry and basic establishment etc. Through these countermeasures promote the harmonious development of economy、social and environment in Ningxia rural.

  目次

  Study on the Ecological Environmental Problems of the Riparian Zone under Interactions of the Soil and Water Fan Xiaohua, Xie Deti , Wei Chaofu 2006, 22 (10):  374-374.  Abstract + ( 1391 )   After the running of Three Gorges Reservoir，the riparian zone which the ecotone of water aquatic ecosystem and the terrestrial ecosystem will come into being. In this paper, on the basis of investigating the type, distribution and area of riparian zone, studied the water and soil environment changed characteristic and analyzed the influence of the interactions of soil and water of riparian zone，some countermeasures such as buffers etc technologies have been proposed for the ecological environmental protection of the riparian zone.

  农业资源与环境科学

  The Research Advance on Resource Plant Fagopyrum dibotrys. Liu Guangde, Li Mingyang, Zhu Qinlong, Li Yandong, Shui Shunzhao 2006, 22 (10):  380-380.  Abstract + ( 1680 )   China is one of the major produce Natural Medicines country with his more than 30,000 higher plants, and also occupies head of the Northern Hemisphere. Exploituring variety of new drugs from natural products attracted the scientists for their studies in recent 20 yeas. In China, the research of plant resources has enormous progress since1970s. China is the world center of buckwheat?origin and genetic diversity. Fagopyrum dibotrys., one of perennial herbs of the genus Polygonaceae in the Fagopyrum Mill family, origins from southwest of china, and ranges from Shanxi, Jiangsu, Zhejiang, Jiangxi, Henan, Hunan, Hubei, Guangxi, Guangdong, Sichuan, Chongqing and Yunnan ect.. It is an important resource plant with rich nutrition and medicinal utilization values, and contains a large number of excellent genes. As an important tradition Chinese Medicinal Materials, the active extract of earthnut (secondary metabolites ) of Fagopyrum dibotrys is one of main constituent of many efficient drugs, and has prominent functions in anti-cancer, controlling tumour cell affect and transfering to lung, and anti-inflammatony antibacteria ect.Besides, because proteins of its seeds are complete, contents of necessary amino acid are high, and vitamin and microelement are rich, it becomes one of perfect health-care foods. At present, cultivated yield is restricted, and cultivated species are lower than wild type in nutrition worth, efficient constituents for medicine and titer, which leads to requesting for Fagopyrum dibotrys largely, so that wild resource is destroyed greatly. In view of the conditions, it is ranked into the second degree of national protected plants. Domestically and abroad resource collection, diversity, physiological characteristic, breeding, pharmacodynamics and ecology environment and other aspects are outspread, however, in the light of function genes research relating to active components of medicine not reported. In order to explore worth of Fagopyrum dibotrys further, and its excellent function genes ,and protect wild resource, in this article , summarize new headway and prospect of Fagopyrum dibotrys in original plant classifying and distributing, diversity, nucleus shapes, chemical and functional components , pharmacology , ecology environment, breeding and tissue culture.

  目次

  Establishment of GIS-based County Land Resources Database and Its Application on evaluate arable land productivity Tang Qunfeng,, Wei Zhiyuan, Tang Shumei, Qi Zhiping 2006, 22 (10):  390-390.  Abstract + ( 1836 )   This dissertation uses modern theory and method of arable land resource management, intergrates knowledge of GIS technology, according to the data of the second general survey soil, replenish mass data for database through investigating on the spot, choose GIS software, has established Ding’an county’s arable land resources database with 1:50000 scale. On the base of these databases, we has choosed 12 essential evaluative factors, such as drainage capability, crop rotation system, parent material, soil erosion type, soil acidity, organic matter, total nitrogen, available phosphorus, available potassium, exchangeable magnesium, plow layer depth, obstacle layer type. It was obtained 2411 evaluation units by laying over soil map and fundamental farmland protection plot map or current landuse map. According as the theory of Fuzzy Mathematics, adopting Telphi Principle, Analytic Hierarchy Program and Addition Model to calculate the compositive index of arable land productivity, and applying the principle of equidistant grading to form the grade of arable land productivity. According this time survey of arable land Ding’an county mainly to paddy soil, we have looked out the area of was 66729.47hm2. Aggregate index was applied to grade the grade of Ding’an county arable land, grading result as follows: grade two the area was 2241.60hm2, grade three was 27261.27hm2, grade four was 26065.93hm2 and grade five was 11160.67hm2, sharing each percentage as 3.36%, 40.85%, 39.06% and 16.73%, respectively. There were not grade 1, grade 6, grade 7 and grade 8 arable land, there was greater area in grade 3 and grade 4 arable land. The arable land productivity was medium level in China in term of the productivity classify system of nation-wide arable land.

  农业资源与环境科学

  The Gray Correlation Analysis of Agricultural Structure and the Development of the Superior Industry in the Middle Region of China Wu Kai, Lu Bu, Yuan Zhang 2006, 22 (10):  397-397.  Abstract + ( 1300 )   The applications of the gray correlation analysis and the relation analysis on optimizing agricultural structure in the Middle Region of China were preliminarily analyzed, which include the village economy, the gross output value of farming, forestry, animal husbandry and fishery, the grain output, the meat output, the elements with the bigger contribution were respectively determined, and the research series were respectively simulated and forecasted using the time series models in this paper. The present situation of agricultural structure in the Middle Region of China was: the non-agricultural industry with an increasingly important contribution, the farming-animal husbandry industrial structure, the superior industrial zones of grain crops including high quality maize, high quality wheat, high quality rice and high quality soybean, and the superior regions of high quality ox or sheep production. In this connection, according to the regional resource superiorities in the area, the high quality rice, high quality wheat, high quality maize and high quality soybean should be energetically developed, the superior ox or sheep industry should be vigorously developed, and the superior non-agricultural industry should be devoted major efforts to developing in line with local conditions.

  目次

  Screen out the High Quality and Resistant Disease Tobacco Germplasm Resources Xu Meiling 2006, 22 (10):  402-402.  Abstract + ( 1381 )   10 flue-cured tobacco germplasm resources with good comprehensive characters has been screen out from 167 germplasm resources in the field test in 2002, and with ulterior motives research in the next year. The result shown that there are 5, 3 and 2 germplasm resources resistance or medium resistance to 3, 2, and 1 kinds of the primary diseases such as TMV, blank shank, and tobacco root knot nematode separately. And also screen out 4 and 4 germplasm resources with low nicotine below 1% and 1% to 2% separately. There are 4 germplasm resources bud 6 to 8 days earlier than K326, and 3 germplasm resources bud 5 to 12 days later than K326 to be identified. H80A432、Islangold and Panyuanhuang were be screen out which have good economic character, leaf face quality and immanency quality. Those germplasm resources will be recommend to breeding workers to be use.

  Research on Exploitative Potential and Status Quio of Wilding Vegetation Resources in Maowusu Sandy Land Kang Furen, Wang Pengke, Wang Lixiang 2006, 22 (10):  407-407.  Abstract + ( 1300 )   After elementary surveying on the status quio of wilding vegetation resources in Maowusu Sandy Land, the paper analysis’s the succession law of plant community and the evaluates exploitative situation of wilding vegetation resources. The results show that there are 11 variations, 4 subspecies and 401 species, of cause including fern, which belonging to 68 families and 224 genuses’. Among the resource of advanced vegetation, 3 species are in B-level severe danger and 7 species are in C-level severe danger which the government protected. And there are about 218 species utilized as fibrous, starch and sugar, herb medicine, pigment and vitamin material plants would be explored in the future.

  农业资源与环境科学

  Nitrogen Release Characteristic of Dianchi Lake Sediment Xu Xiaofeng, , Yang Hao, Lv Junjie 2006, 22 (10):  411-411.  Abstract + ( 1384 )   Nitrogen release characteristic of Dianchi lake sediment and the nitrogen nutrients concentration of overlying water body was studied through simulating cultivation. The results indicated that under disturbed sediment released N nutrients to overlying water body markedly. The dead cells of phytoplankton could promoted organic nitrogen of sediment mineralization. The amount of nitrogen nutrients released of sediment was correlation with the amount of dead cells of phytoplankton being deposited. Ammonia was the main form of the nitrogen nutrient being released into overlying water body, and it was transformed to nitrite soon. And then nitrite was transformed to nitrate.

  The Germplasm Resource and Flora of the Medicinal Plants from Lamiaceae in Henan Sun Huizhang, Song Yueqin 2006, 22 (10):  414-414.  Abstract + ( 1470 )   To accumulate basically materials of the medicinal plants from Lamiaceae in Henan, and provide data for its utilization, conservation, artificial reproduction and enlarging population of wild resources, The germplasm resource and floristic phgtogeographical features of medicinal plants from lamiaceae in Henan are analyzed by conducting field investigation and consulting specimens and related data. Results showed that: there are Comprise 31 genera 60 species, the element of the flora come from different floras and show obviously temperate characteristics, and the flora is crisscrossing mixing and transition. This characteristics of flora is in line with climate of Henan.

  Research on Wild Fruit Trees Germplasm Resource of Rosaceae in Qinghai Province Guo Shuxian, Wang Dongmei, Zhou Jinsong 2006, 22 (10):  417-417.  Abstract + ( 1501 )   According to the investigation and plant specimen and collected documents, the conclusions are obtained, which are described in the following, 60 species（including 2 varieties and 1 form）of Rosaceae wild fruit trees are found in Qinghai province, which belong to 10 genera, amount for 53.6% of the wild fruit trees of the whole province. Among them Rosa and Cotoneaster are most abundant, have respectively 13 species and 12 species, secondly Rubus and Prunus have respectively 9 species and 8 species, these 4 genera account for 70% of Rosaceae wild fruit trees of Qinghai province. There are 3 fruit types that are pome, aggregate and drupe, among them the pome and aggregate have a greater proportion, respectively share 45% and 40% of the whole species numbers. Not a few categories of Rosaceae wild fruit trees of Qinghai province have the characteristics as anti-cold and anti-drought, etc, and can be used as stock or materials of breeding, some fruits species are nutritious. They mainly distribute on Yellow River, Huangshui River basin and Datong River drainage basin in the eastern of Qinghai province, are divided into Xiqing Mountain area, Qiliansan Mountain area, and the altiplano of southern Qinghai province area, the species and distribution of each area were analyzed. The vertical distribution is on the altitude1800~4000m. Otherwise appraise some important of wild fruit trees resources, and put forward some suggestions about their exploitation and utilization.

  热带农业科学

  Study on Growth and Development rule of Kangua Fruit Cao Zhenmu, Liu Weixia, Zhan Yuanfeng, Zhang Xiuming 2006, 22 (10):  422-422.  Abstract + ( 1414 )   This paper studied the daily variation of volume, length, and diameter of kangua, also studied different degree of maturation, different cutting length, and continuous cutting on the growth effect. The results showed that the relationship between the growth and volume, length, and diameter of kangua followed the growth curvature of Logistic. Cutting at different degree of maturation were highly significant on the growth of kangua, while within a given period, different cutting length and continuous cutting were not.

  Studies on Nutrient Characters of Super Sweet Corn Lin Dian, Wangchang, Ye Ding Qiang, ZhaoHueiCheng 2006, 22 (10):  426-426.  Abstract + ( 1385 )   To elucidate law of nutrient and accumulation changes of super sweet corn, The samples were analyzed in fixed time. The nutrient characters of super sweet corn were studies. The results showed that order of amount of various nutrients in the sweet corn was N>K>P>Ca>S>Mg;. Nutrient contents changed with growth stages and different organ, the contains of N、P、Mg、S in fruit were largest，the contains of Ca in leaf was largest, the contains of K in stem was largest; the contains of P, K, Mg in leaf were consistent relatively with total; the contains of N、Ca in stem were consistent relatively with total; The ratio of N、K、Ca was changed with growth stages; N：P：K：Mg：S=1:0.10:1.41:0.10:0.05:0.06in mature stages.

  Study of Isolation of Antabonistic Actinomyces from Soil in Hainan Province Shi Xuequn, Song Haichao, Liu Zhu 2006, 22 (10):  431-431.  Abstract + ( 1436 )   During the isolation of antabonistic actinomyces from soil in Hainan province, we solved the issues of a contamination by bacteria and fungi. In study, we tested the best concentration of effective convenient, cheap inhibitor K2Cr2O7 that can impure antabonistic actinomyces, and the soil were treated separately by heating high temperature 120℃ and drying in air. The best soil store time of isolating the antabonistic actinomyces was also did. The results showed that the right concentration K2Cr2O7 is 50μg／ml, The antabonistic actinomyces strains is 30~40 when the soil diluting concentration in 10-3~10-4,the efficiency is best. The soil staying in air after a week’s isolated more antabonistic actinomyces strains than that Heated by high temperature 120℃.

  目次

  Effect of Vermicomposting on Growth of Cutting Root and Rhizosphere to Longan Xue Jinjun,, Lin Senye, Deng Libao, Lao Tailei 2006, 22 (10):  436-436.  Abstract + ( 1729 )   To investigate the influences of vermicomposting on growth of cutting root and rhizosphere, the experiment was carried out. Shixia longan was used as tested plants. The cuttin root was put into the rhizosphere bag that was contained vermicompasting, cow dung and orchard soil, respectively. The results showed that: the quantity of fresh roots in vermicompasting and cow dung improved 342.3% and 231.6% compared with the orchard soil, respectively. The content of nitrogen in vermicompasting was higher 144.3% and 434.1% than in cow dung and in orchard soil, respectively. The content of phosphorus in vermicompasting was higher 366.5% and 1256.0% than in cow dung and in orchard soil, respectively. The content of potassium in vermicompasting was higher 248.9% and 392.0% than in cow dung and in orchard soil, respectively. Compared with the orchard soil, the quantity of actinomycete in vermicompasting and cow dung improve 240.5% and 211.1% ,respectively.The quantity of germ improve 255.9% and 229.6%, respectively.The quantity of epiphyte in cow dung improve 204.6% then orchard soil, but vermicompasting and orchard soil was similar. Therefore, vermicompasting was the best matter suitting to groth of root.

  热带农业科学

  The Infection of the Tree Suspend Bottle Accurate Transfusion Technology on Mango Output Zhang Yaohui, Qi Jianlong, Lin Chixian 2006, 22 (10):  439-439.  Abstract + ( 1432 )   The mango increase production domino affect was confirmed by using the tree suspend bottle accurate transfusion technology with injecting nutrition liquid into tree staff xylem from florescence to autumn. The test result indicated: the mango fruit number, single fruit weight and chief output were increased by 23.85%, 22.77% and 52.06%. The 0utput/investment (3.38:1) of chief output was 1.48 times than comparison (2.29:1). The math model (?=5.15383(D)3.09674(g)) of extractive transfusion drug and fertilization volume in the mango was deduced using quantitative analysis and computer simulate method. In the paper, the causes of mango increase product were analyzed and discussed.

  目次

  Comparative Analysis on Storability at low Temperature of Ziniangxi and Xiaodingxiang Litchi Fruit in Relation to some Physiological Activities Gao Aiping,, Li Jianguo, Hu Weirong, Chen Yeyuan, Wang Zehuai, Zhu Min 2006, 22 (10):  442-442.  Abstract + ( 1790 )   Fruits of Litchi cultivars Ziniangxi and Xiaodingxiang were used for the experiment to determine the storability at low temperature in relation to some physiological activities. Results indicated that Ziniangxi has a better storage capability. During storage at low temperature (5±1)oC, relative electric conductivity, pH value, PPO and POD activities of litchi pericarp increased, whereon anthocyanin and general hydroxybenzene decreased. At the same time, Xiaodingxiang had higher value in relative electric conductivity, pH value, PPO and POD activities and anthocyanin content, Ziniangxi had higher value in general hydroxybenzene content.

  农业信息科学

  Application of Information Technology in Soil Determination and Prescription Fertilization Zhao Yanping, Ma Youhua, Wang Qiang, Hu Hongxiang, Zhao Jianxun, Qian Guoping, Qian Xiaohua, Qiu Ningning 2006, 22 (10):  446-446.  Abstract + ( 1405 )   This paper discussed the characteristic of information technology applied on soil nutrient management and fertilizing technology in occident, analyzed the requests of soil determination and prescription fertilization for information technology and it developing trend in china, pointed the requests, tasks and contents of information processing in it at present in our country, and analyzed the questions about it at Agricultural technology extension station in counties. The application of information technology in soil determination and prescription fertilization mainly conclude these, (1) applying the database technology and GIS, and processing the data about soil and fertilizer and the maps connected according to the standard, to establish the attribute database and space database, and management system. (2) using GIS and database, combining the application, to establish application system such as tilth estimate system and applying decision system.(3)utilizing network technology to realize database sharing and long-distance applying decision on web.

  农业信息科学或植物生理科学

  Actualization of Calculating Functions on Photosynthetic Pigment Base on ASP Zhang Jinzhong, Wen Xue, Peng Changlian, Liang Xian, Lu Yuming 2006, 22 (10):  451-451.  Abstract + ( 1363 )   Calculating functions on photosynthetic pigment have been compiled base on ASP technology, and the system of functions include many important parameters about photosynthetic pigment, so the scholar of scientific research can attain the all-around results rapidly and save time. At the same time, the system reserves more space for new functions and parameters that scholar need by the design of modularization.

  农业工程科学

  Analysis of Field evapotranspiration status in liaoning Province Zhang Shujie, Ban Xianxiu, Ji Ruipeng, Zhang yushu 2006, 22 (10):  454-454.  Abstract + ( 1374 )   The paper is a case study in liaoning,On the base of the routine weather data and the constant observational data of soil moisture for 18 representative stations during 1981~2002, the field actual evapotranspiration dynamic model of five regions in the Liaoning province was established under different supply water. By using the function relationship, the actual evapotranspiration was calculated in natural condition in lianning .The Results showed that the annual change of the actual evapotranspiration was in single-peak type,the peak value occurred during booting flower stage of corn.The regional distribution of the actual evapotranspiration was higher midst than all around,the trend of regional distribution of evapotranspiration didn’t conform to that of natural precipitation.The field actual evapotranspiration wave during 1981~2002, It is the higher the field actual evapotranspiration of the more precipitation year than that of the natural precipitation year, the actual evapotranspiration is appearing the increasing tendency in the central, eastern,southern and northern region of Liaoning province in 1990s,but the actual evapotranspiration is appearing the descending tendency in the western region of Liaoning province in 1990s.

  目次

  Effects of Osmotic Stress on Water Status and Growth of Winter Wheat Seedlings Zhao Liying, Deng Xiping, Shan Lun 2006, 22 (10):  459-459.  Abstract + ( 1513 )   In the paper, two winter wheat varieties, shaan 253 and changwu 134, were used in the experiments. Water culture in artificial growth shelter was designed to investigate response of water status and growth. The results showed that the relative water content, water potential and leaf area showed the trend of drop in the course of osmotic stress, however, root length, root area and root/shoot showed first increase then drop. The maximum value reached at stress 24h for shaan253, and 30h for changwu134. There were not marked changes of chlorophyll a and b before stress 30h, but rapidly dropped with the subsequent drought. It was indicated that the content of chlorophyll was not affected by the moderate drought.

  水产渔业科学

  The Actual-effect of Fish Culture in Paddy Fields on Utilization Ratio of Agricultural Resource in Guangxi —The Influencing Analysis Of Paddy-Field-Fish-Culture On The Yield Of Rice Paddy At The Present Time In Guangxi. LI Yu-lin，Liu Yian-li 2006, 22 (10):  467-467.  Abstract + ( 1552 )   For research the actual-effect of fish culture in paddy fields on utilization ratio of agricultural resource in large-scale area in a usual year, the method is to collect and analyze first-hand data of input and output ,Which come from 262 farmers and their family and 50.59 hektare on the yield of rice paddy in 8 villages of 5 counties (QuanZhou, XingAn, RongShui, SanJiang, PingNan) with more paddy-fields-fish-culture and 1 village of 1 counties (HengXian) without paddy-fields-fish-culture. This villages are located in the northern region, northwest region, southeast region of Guangxi. Here are the results: (1)The rice yield: The rice yields per time of 8 villages with paddy-field-fish-culture had a higher output than the average of their county. Three of them had an extremely higher output, and the others five villages were not so much notable output.(2)The chemical fertilizer usage: 6 inquired villages with paddy-field-fish-culture had a chemical fertilizer usage plan, Their chemical fertilizer usage is notable lower than the other villages without paddy-field-fish-culture in the same counties. (3)The pesticide usage: six of villages with paddy-field-fish-culture had the pesticide usage plan. ①The pesticide input of 6 inquired village with paddy-field-fish-culture was 404.93(yuan/hm2) lower than the input of a village without paddy-field-fish-culture at least, the lowest was 1098.98(yuan/hm2). ②The pesticide input of 6 inquired village with paddy-field-fish-culture for a ton of rice yield was 25.30(yuan/hm2) lower than the input of a village without paddy-field-fish-culture at least, the lowest was 91.84(yuan/hm2). ⑷The net income: The net income of villages with paddy-field-fish-culture was averagely 5362.73 (yuan/hm2) higher than the net income of villages without paddy-field-fish-culture in the southeast region of Guangxi. Micro-study show that the paddy-field-fish-culture can remarkably promote the utilization-ratio of agriculture resource in Guangxi province.

  Effects of Cellulase on Growth Performance, Feed Digestive Rate and Whole Body Composition in Grass Carp Gao Chunsheng,, Fan Guangli, Li Jianhua, Yang Guoyu 2006, 22 (10):  473-473.  Abstract + ( 1377 )   A 49-day feeding experiment was conducted to investigate the effects of different levels of Cellulase supplement on growth performance, feed digestive rate and body composition in grass carp (average body weight was about 47.8 g) . The basal diet was applied as control, in which 0.05%, 0.10%, 0.20% of Cellulase were added into basal diets as test diets, respectively. Each test diet was applied for duple tanks and 30 fish were stocked randomly in each tank. Every group was fed 4 times every day. The results showed: The food added Cellulase could improve gain weight rate of grass carp and digest rate of DM, CP, EE and CF. It could also decrease food coefficient. But it had no difference effect on whole body composition.

  目次

  Regulation of Fe on Growth and Material Accumulation of Dunaliella salina Yang Xiaoling, Guo Jinyao 2006, 22 (10):  476-476.  Abstract + ( 1441 )   The experiment study regulation of different consideration Fe on growth and material accumulation of Dunaliella salina. Result shows more and less Fe go against Dunaliella salina cell growth and material accumulation. Fe of 30mg/L is advanced function on growth、protein synthesizes and β-carotene accumulation of Dunaliella salina in culture medium. the result can use to commercial culture of Dunaliella salina.

  农业传媒科学

  Journals of Agricultural Science and Technology Ought to Regard the Developing Viewpoint in Order to Benefit Liang Xiuling 2006, 22 (10):  479-479.  Abstract + ( 1223 )   The paper first presents the problems existing in the development of journals of agricultural science and technology, that is most of such journals make a loss but few of them get profits. Then it brings forward some strategies, including updating notion of management, following the market, optimizing the journals’ contents and building the name in order to establish a developing viewpoint focusing on benefit. Besides, the service-for-readers awareness and market awareness are also important for the journals to raise both economic and social benefits. The past extensive increasing model, which thinks high of the academic level but disregards the economic benefit, should also be charged. Instead, the journals should give weight to their circulation and accept an appropriate number of commercials so that the journals of agricultural science and technology can go on the track of sound progress.

  ituation of Chinese Fishery Scientific Journals and their Development Countermeasures in the Iinternationalization Zhang Xiaoqin, Wu Jun 2006, 22 (10):  483-483.  Abstract + ( 1401 )   The purpose of this study is to clarify the status quo of Chinese fishery scientific journals so to find out some countermeasures in the development of fishery scientific journal’s internationalization. Eight main scientific journals in fishery research are used, which were all covered in the CHINESE S&T JOURNAL CITATION REPORTS (2005). The Impact Factors and Total Cites of them were analyzed and compared with those of the 1608 journals covered in the CSTJCR (2005). The results showed that the average Impact Factors of the eight journals was 0.353, which was lower than that of 1608 journals’ average in CSTJCR (2005). And the Total Cites had the same situation. But the average funded article ratio of the eight journals (0.57) was higher than the total average ratio of the 1608 journals’ (0.41), which indicated that the government has been increasingly funded fishery scientific research. However, the articles in the eight journals produced from international collaborative projects are few, of which the ratio of the total articles was just 0.011. According to the participation of the eight journals in international retrieval systems, most of them have joined more than five. So we can say there is some great potentiality for the fishery scientific journals to make progress in international development, but it takes time. So they should focus on domestic development at present and care overseas development; gradually enlarge the affecting range in the world.

  三农问题研究

  The "Endless" Chinese Villages Zhang Dingru, Cai Xuexiong 2006, 22 (10):  487-487.  Abstract + ( 1313 )   The full industrialization and sufficient urban employment capacity which would absorb all the surplus labor force in rural areas is necessary and adequate for the Village "Ending". China's industrialization and urbanization did not and could not reproduce the primitive accumulation of capital as industrialized countries did for history. It is impossible to reproduce the first industrialized countries historical process of evolution of the industrial structure. Non-agricultural employment pressure and the grim reality of the frequent movement of peasant workers between urban and rural indicates that China's industrialization and urbanization can never absorbs tremendous rural population. It is clear that the future of China's villages can not "ending." Thus correcting "Center City Theory" from theoretically angel is necessary for the practice of building new socialist rural areas and rural urbanization.

  目次

  Thinking about how to Build Green Brands in the Development of urban Agriculture in Wuhan city Zhang Xiumian, Dong Limin 2006, 22 (10):  492-492.  Abstract + ( 1618 )   Be a kind of new appearance of the modern agriculture, urban agriculture is the result that the city country integral whole turn. At the beginning of this century, Wuhan city began to explore urban agriculture, and after several years’ development, urban agriculture in Wuhan city has taken shape, but in the fierce market competition, the problem that the brands of green agricultural products have little competitive strength is restricting the further development of urban agriculture in Wuhan city. Conducted the present condition and green brand constructions to green agricultural product brand in Wuhan City in the text to carry on the substantial evidence in the existent bad situation analysis, and plant the technique and push forward the agriculture to standardize to produce from an excellent product agriculture, enlargement of development new species development strength, the adoption living creature four put forward urban agriculture counterplan suggestion that creates the green brand to develop Wuhan.

  三农问题研究

  The significance of Developing Model Rural Education and The study of its intension and characteristic He Yun Feng 2006, 22 (10):  497-497.  Abstract + ( 1461 )   it has the important impetus function to realize the sustainable development with modern rural education to uplift qualities of population, promote the labors transfer, comprehensive construction richness society development with modern education. The paper analyze era background and characteristic in modern rural with perspective of sustainable development, distinct its intension and the characteristic of district, diversify, actual effect, the back modernity characteristic, etc.

  目次

  Problems of Vocational Technical Education During the Development of Chinese Human Resources in the West Countryside Xu Wenjun 2006, 22 (10):  502-502.  Abstract + ( 1350 )   The current anti-poverty, surplus labor force's shifting and agricultural structure’s adapting set a higher request to the development of human resource in the west countryside. Because of the defect of basic education and the difficulty in university graduates' returning to the west countryside,vicational－technical education becomes the main gateway to develop human resources there.

  三农问题研究

  Developing Agricultural Sightseeing, Creating New Country Vision ——The Exploitation Planning of the Jiuding Mountain Ecology Agricultural Sightseeing Garden in Jinan Chen Dongtian, Yan Yingchong, Zhang Xiaohong 2006, 22 (10):  506-506.  Abstract + ( 1320 )   Agricultural sightseeing is a new outcome which is the combination of modern agriculture and tourism. It has walked on the standardization developing way in Europe, America, Japan and other developed countries. In recent years, many types of agricultural sightseeing gardens are rising in China and showing infinite life force and strong developing potential. According to the present condition of Jiuding Mountain，the concept and thought of planning are put forward in this paper, the whole layout and structure planning are basing on history and ecology. The main landscape areas are especially introduced and illustrated. Moreover, some thoughts for exploitation and development of agricultural sightseeing are made in order to provide theories for developing agricultural sightseeing gardens in the future.

  Study on Measures of Quality Sundry Grain Development Cost-Effectiveness in Shanxi Province Cui Keyong, Fan June 2006, 22 (10):  510-510.  Abstract + ( 1382 )   We have conducted a statistical survey on machining, currency and authentication for food with no pollution of sundry grain in Shanxi with the result that the commodities of sundry grain in Shanxi Province account for 10% of the total production while the processing only 2%. Sundry grain processing enterprises are basically small and medium-sized with variety and diversity of processed products and integrated processing nature which determine the production to volume of sales by flexible marketing means. A large number of winning products of sundry grain and even many high-grade winning products in Shanxi province were not large-scale developed and nor played a strong role in promoting the development of base. on this basis, advantages of current quality sundry grain industry in Shanxi Province has been sought out. After that, we put forward measures for the development of quality sundry grain industry in Shanxi Province.

  The Analysis for the Development of Pollution-free or “Green” Agricultural Industries in Shangluo Mountain Area Zhang Xiaohu 2006, 22 (10):  514-514.  Abstract + ( 1195 )   Through mountain location situation, climatic conditions, land resources, biological resources, environmental origin analysis, the author pointed out that Shangluo has the comparative advantages in the development of pollution-free or “green”agricultural industries. The author also pointed out the guiding ideology for the development ,basic principles, objectives and direction of work against the development and the existing problems, and went further into the completed production base, a property development, a leading enterprises and social services response improvement.

  Empirical Study on Estimation of China’s Potential Output Dong Limin, Lv Lianju, Zhang Xiumian 2006, 22 (10):  519-519.  Abstract + ( 1215 )   With the evaluation of current study on the estimation of China’s potential output, this article estimates China’s potential output, output gap and the potential output growth rate between the year of 1978 and 2004 by H-P Filter and Production Function Approach. The result shows that: firstly, the output gap of China demonstrates the classical cycle that the fluctuation level alternates in a positive and negative way between 1978 and 2004; secondly, the output gap fluctuates dramatically and frequently before 1995 and smoothly after 1996 especially after 1999; thirdly, since 1997, though the economic growth rate has maintained a high level, the actual utilizing level of factors of production has been declining gradually; fourthly, the results of the Production Function Approach basically reflect the utilization of factors of production since the reform and opening-up during which China has transited its economic system from planned economy to market economy and established the market economy; fifthly, according to the potential output estimated separately by HP filter and production function approach, the average potential output rate from 1978 to 2004 is 9.54% and 9.67% respectively. Accordingly, it is a much better choice to stabilize the economic growth rate of China at the level of 8% or 9% through the appropriate macroeconomic control in the following years.

  目次

  Discussing of the Problems of Agriculture, Countryside and Farmer on Western regions in New Stage Chen Xiaolin 2006, 22 (10):  525-525.  Abstract + ( 1600 )   To solve the problems of agriculture, countryside and farmer, especially in the western regions of china, is the key to realize the Great Goal of fulfilling well-off society and constructing a Socialist Harmonious Society. This thesis expands the form and causes of the problems of agriculture, countryside and farmer of western, and puts forward that we may solve the problems of agriculture, countryside and farmer, form these ways: Promoting innovation of system; Realizing intergradations between the city and countryside; Increasing devotion on the problems of agriculture, countryside and farmer, Building Modern Agriculture; Adhering to the people-oriented principle; Improving the Quality of Peasants; Deepening rural reformation and Protecting farmers’ interest.

  三农问题研究

  Basing on Independent Self-innovation Accelerates the Development of the Food Industrialization of Fujian Zhang Haifeng 2006, 22 (10):  529-529.  Abstract + ( 1245 )   In order to relieve the imbalance between supply and demand of grain in Fujian Province and to guarantee grain security of Fujian, current situation of the grain-production supply and demand and restriction factor had been analyzed. It posted the essential character of food industrialization management and the actual states in Fujian province. At the same time, eight effective measures, which accelerated the development of food industrialized, were put forward according to the intension of self-innovation. They were as follows: Scientific and technical innovation to improve the yield per acre, further increase the total amount of grain; mechanism innovation to perfect the circulation mechanism of the right to use the land and advance the appropriate scale of operation of the grain field step by step; development innovation to expand the grain-production industry chain; market innovation to establish the scientific system of buying and selling of grain; system innovation to implement the grain risk funding system; service innovation to set up and perfect the agricultural social service system ; strengthen training to improve workforce's quality and finally innovation in thought to develop the industrialized management mode of export-oriented grain.

  The Practice and Exploration of Closely Union of Production-Education-Research Xie Enkui, Wang Jun, Hou Pei 2006, 22 (10):  533-533.  Abstract + ( 1126 )   This article reveals that agricultural production-education-research closely union to become one kind of development tendency from the domestic and foreign agricultural development. It’s an effective way to promote the development of agricultural science and technology and the economy. Many developed and developing countries like US, England, Japan etc., each one all extremely take and established each kind of research and manage entity. Refers to the developed countries’ measures, means and beneficial experiences, unifies this unit actual situation, The authors carry on the discussion from explore the new pattern and mechanism, multi-level optimization, base "three agriculture", talented person raise, perfectly consummates on system etc.. To further explore specific circumstances, enhances strong points and avoid weaknesses, to search for new development.